Incidental Mutation 'R1605:Vmn1r34'
ID176392
Institutional Source Beutler Lab
Gene Symbol Vmn1r34
Ensembl Gene ENSMUSG00000091012
Gene Namevomeronasal 1 receptor 34
SynonymsGm5991
MMRRC Submission 039642-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R1605 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location66635936-66643879 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 66636948 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 269 (M269L)
Ref Sequence ENSEMBL: ENSMUSP00000153720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074381] [ENSMUST00000226262] [ENSMUST00000226910] [ENSMUST00000226999] [ENSMUST00000227332] [ENSMUST00000228498] [ENSMUST00000228647]
Predicted Effect probably benign
Transcript: ENSMUST00000074381
AA Change: M269L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000132900
Gene: ENSMUSG00000091012
AA Change: M269L

DomainStartEndE-ValueType
Pfam:V1R 28 293 2.2e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226262
AA Change: M269L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000226910
AA Change: M269L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000226999
AA Change: M269L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000227332
AA Change: M269L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000228498
AA Change: M269L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000228647
AA Change: M269L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 99% (75/76)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700027J19Rik T A 7: 4,151,396 H131L probably benign Het
1700123L14Rik A G 6: 96,164,812 M417T probably benign Het
4931408C20Rik A T 1: 26,684,430 H556Q possibly damaging Het
5730409E04Rik A G 4: 126,612,311 K211E probably damaging Het
Acot7 A G 4: 152,206,828 I84V possibly damaging Het
Ankrd44 A G 1: 54,828,622 V34A probably benign Het
Atp4b A T 8: 13,393,489 M63K probably damaging Het
Atr T A 9: 95,936,463 I2163K probably damaging Het
Azgp1 A T 5: 137,985,164 R34* probably null Het
Ccdc152 T G 15: 3,298,121 K58T probably damaging Het
Ccdc88b T A 19: 6,850,469 Q912L probably benign Het
Chd7 G A 4: 8,844,675 E1595K probably damaging Het
Col11a1 G A 3: 114,131,641 G41D probably damaging Het
Cyp2b23 C T 7: 26,686,418 V5I probably benign Het
D430041D05Rik A G 2: 104,255,570 V22A possibly damaging Het
Ddi1 T C 9: 6,266,012 Y119C probably benign Het
Dysf T C 6: 84,106,941 L785P probably damaging Het
Eqtn T A 4: 94,928,350 T69S possibly damaging Het
F11 T A 8: 45,241,580 K581N probably damaging Het
Gli2 G A 1: 118,854,560 P172S probably damaging Het
Gm10093 A G 17: 78,492,108 D176G probably damaging Het
Gm7579 G T 7: 142,211,866 C3F unknown Het
Grin2a A G 16: 9,663,330 V501A possibly damaging Het
Grk4 G A 5: 34,674,557 D57N probably damaging Het
Gsdma A T 11: 98,666,493 D86V probably damaging Het
Gsx1 A G 5: 147,189,928 E187G probably damaging Het
Inpp5k T A 11: 75,633,481 F75L probably benign Het
Itpr1 T C 6: 108,349,659 V114A possibly damaging Het
Izumo3 A T 4: 92,144,740 C130S probably damaging Het
Mei4 G A 9: 81,927,586 E241K possibly damaging Het
Mocs2 T C 13: 114,824,584 V39A probably benign Het
Mroh2b G A 15: 4,945,090 R1184H probably benign Het
Msh3 T C 13: 92,300,275 Q509R probably null Het
Myh8 T C 11: 67,301,671 W1459R probably damaging Het
Mypop T A 7: 19,000,993 probably benign Het
Ndc1 C A 4: 107,368,096 T3K probably damaging Het
Nf1 A C 11: 79,440,923 M695L probably benign Het
Nutm2 C A 13: 50,469,919 D217E possibly damaging Het
Olfr1484 A G 19: 13,585,630 T109A probably benign Het
Olfr243 T C 7: 103,716,651 I19T probably damaging Het
Pde6c C A 19: 38,141,492 D283E probably damaging Het
Phldb2 A G 16: 45,770,779 probably benign Het
Pigt G C 2: 164,507,499 R574P probably damaging Het
Pkd1 T C 17: 24,577,526 I2354T possibly damaging Het
Prdm15 T C 16: 97,839,306 E27G probably damaging Het
Ptpn14 A G 1: 189,865,512 I1140V probably benign Het
Rdx T C 9: 52,063,591 V9A probably damaging Het
Rfx7 T C 9: 72,611,789 S258P probably damaging Het
Rnf17 G T 14: 56,493,365 G1209C probably damaging Het
S1pr4 C T 10: 81,499,391 probably null Het
Scml2 G T X: 161,231,446 E566D possibly damaging Het
Serpinb1b T A 13: 33,093,663 V293E possibly damaging Het
Serpinb9b T C 13: 33,038,129 probably null Het
Sez6l A C 5: 112,475,049 I212S probably damaging Het
Son T C 16: 91,657,664 S1100P probably damaging Het
Spag9 G A 11: 94,048,539 R98H probably damaging Het
St3gal5 T C 6: 72,142,288 L128P probably benign Het
Stra6 A T 9: 58,151,883 M510L probably benign Het
Stxbp5l A G 16: 37,208,111 V530A probably benign Het
Tatdn1 A G 15: 58,921,190 probably benign Het
Tbc1d8 A G 1: 39,391,125 S466P probably benign Het
Tmem199 A T 11: 78,508,326 M175K possibly damaging Het
Trmt12 A G 15: 58,872,915 E54G probably benign Het
Usp37 G T 1: 74,493,004 Q77K possibly damaging Het
Vezf1 A G 11: 88,076,299 I301V possibly damaging Het
Wdr93 C A 7: 79,771,509 probably null Het
Wnk2 T C 13: 49,060,894 D644G probably damaging Het
Zc3h13 C T 14: 75,337,483 R1591* probably null Het
Zfp131 G A 13: 119,768,780 L371F probably damaging Het
Zfp180 T A 7: 24,104,624 V156D probably benign Het
Zfp646 G T 7: 127,880,187 probably null Het
Zscan12 C A 13: 21,366,643 T144K probably benign Het
Other mutations in Vmn1r34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00974:Vmn1r34 APN 6 66637655 missense possibly damaging 0.64
IGL01322:Vmn1r34 APN 6 66636915 nonsense probably null
IGL01866:Vmn1r34 APN 6 66637389 missense probably benign 0.03
IGL02389:Vmn1r34 APN 6 66637058 missense probably damaging 1.00
IGL03356:Vmn1r34 APN 6 66636986 missense probably benign 0.00
R0508:Vmn1r34 UTSW 6 66637408 missense probably benign 0.19
R0601:Vmn1r34 UTSW 6 66637664 missense possibly damaging 0.94
R1381:Vmn1r34 UTSW 6 66636938 missense probably damaging 1.00
R1765:Vmn1r34 UTSW 6 66637496 missense probably damaging 0.99
R2022:Vmn1r34 UTSW 6 66637401 missense possibly damaging 0.90
R3878:Vmn1r34 UTSW 6 66637568 missense possibly damaging 0.82
R4023:Vmn1r34 UTSW 6 66637704 missense probably benign
R4024:Vmn1r34 UTSW 6 66637704 missense probably benign
R4025:Vmn1r34 UTSW 6 66637704 missense probably benign
R4026:Vmn1r34 UTSW 6 66637704 missense probably benign
R4385:Vmn1r34 UTSW 6 66637139 missense probably damaging 0.99
R5274:Vmn1r34 UTSW 6 66637139 missense probably damaging 1.00
R6182:Vmn1r34 UTSW 6 66637328 missense probably damaging 0.97
R6629:Vmn1r34 UTSW 6 66637515 missense probably benign 0.00
R7143:Vmn1r34 UTSW 6 66637664 missense probably benign 0.12
R7689:Vmn1r34 UTSW 6 66637010 nonsense probably null
R8031:Vmn1r34 UTSW 6 66637181 missense probably damaging 1.00
X0066:Vmn1r34 UTSW 6 66637475 missense probably benign 0.02
Z1176:Vmn1r34 UTSW 6 66637125 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAATCTTGCTTTGCTGCTTGAACTATTAAAC -3'
(R):5'- TCAGGGGACTGATTTTAACCATGACAAC -3'

Sequencing Primer
(F):5'- accttacaaacatctctacctcc -3'
(R):5'- CTTGTAGGAGTCATGCTAACCAC -3'
Posted On2014-04-24