Incidental Mutation 'R1605:Zfp646'
ID176403
Institutional Source Beutler Lab
Gene Symbol Zfp646
Ensembl Gene ENSMUSG00000049739
Gene Namezinc finger protein 646
Synonyms
MMRRC Submission 039642-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R1605 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location127876221-127885996 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 127880187 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050383] [ENSMUST00000054415] [ENSMUST00000106261] [ENSMUST00000106262] [ENSMUST00000106263] [ENSMUST00000131000] [ENSMUST00000144721]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050383
AA Change: R512L

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000052641
Gene: ENSMUSG00000049739
AA Change: R512L

DomainStartEndE-ValueType
ZnF_C2H2 8 31 1.36e-2 SMART
ZnF_C2H2 67 89 5.29e-5 SMART
ZnF_C2H2 231 253 3.21e-4 SMART
ZnF_C2H2 258 280 9.58e-3 SMART
ZnF_C2H2 286 308 2.24e-3 SMART
low complexity region 345 362 N/A INTRINSIC
ZnF_C2H2 366 388 5.42e-2 SMART
ZnF_C2H2 393 415 8.34e-3 SMART
ZnF_C2H2 457 479 5.9e-3 SMART
ZnF_C2H2 484 506 4.87e-4 SMART
ZnF_C2H2 566 588 2.32e-1 SMART
ZnF_C2H2 606 628 6.32e-3 SMART
ZnF_C2H2 633 655 1.53e-1 SMART
low complexity region 737 750 N/A INTRINSIC
low complexity region 786 797 N/A INTRINSIC
ZnF_C2H2 806 828 2.17e-1 SMART
ZnF_C2H2 833 855 3.69e-4 SMART
ZnF_C2H2 866 889 1.16e-1 SMART
low complexity region 890 911 N/A INTRINSIC
ZnF_C2H2 941 961 9.31e1 SMART
ZnF_C2H2 1035 1057 1.95e-3 SMART
ZnF_C2H2 1062 1084 3.39e-3 SMART
low complexity region 1149 1163 N/A INTRINSIC
ZnF_C2H2 1170 1192 1.58e-3 SMART
ZnF_C2H2 1197 1219 5.42e-2 SMART
ZnF_C2H2 1225 1247 3.69e-4 SMART
ZnF_C2H2 1266 1286 5.12e1 SMART
ZnF_C2H2 1293 1315 3.69e-4 SMART
ZnF_C2H2 1333 1355 3.11e-2 SMART
ZnF_C2H2 1550 1572 5.9e-3 SMART
ZnF_C2H2 1640 1662 1.08e-1 SMART
ZnF_C2H2 1667 1689 4.11e-2 SMART
ZnF_C2H2 1695 1717 4.11e-2 SMART
ZnF_C2H2 1724 1746 1.45e-2 SMART
low complexity region 1751 1764 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000054415
SMART Domains Protein: ENSMUSP00000056105
Gene: ENSMUSG00000049728

DomainStartEndE-ValueType
ZnF_C2H2 22 44 7.67e-2 SMART
ZnF_C2H2 84 106 9.44e-2 SMART
ZnF_C2H2 112 134 3.63e-3 SMART
ZnF_C2H2 140 162 2.36e-2 SMART
ZnF_C2H2 168 190 1.98e-4 SMART
ZnF_C2H2 196 218 2.91e-2 SMART
ZnF_C2H2 224 246 1.26e-2 SMART
ZnF_C2H2 252 274 5.21e-4 SMART
ZnF_C2H2 280 302 2.57e-3 SMART
ZnF_C2H2 308 330 5.59e-4 SMART
ZnF_C2H2 336 358 1.79e-2 SMART
ZnF_C2H2 364 386 7.9e-4 SMART
ZnF_C2H2 392 414 5.5e-3 SMART
low complexity region 428 470 N/A INTRINSIC
ZnF_C2H2 516 538 3.63e-3 SMART
ZnF_C2H2 544 566 1.3e-4 SMART
ZnF_C2H2 572 594 5.59e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106261
SMART Domains Protein: ENSMUSP00000101868
Gene: ENSMUSG00000049728

DomainStartEndE-ValueType
ZnF_C2H2 22 44 7.67e-2 SMART
ZnF_C2H2 84 106 9.44e-2 SMART
ZnF_C2H2 112 134 3.63e-3 SMART
ZnF_C2H2 140 162 2.36e-2 SMART
ZnF_C2H2 168 190 1.98e-4 SMART
ZnF_C2H2 196 218 2.91e-2 SMART
ZnF_C2H2 224 246 1.26e-2 SMART
ZnF_C2H2 252 274 5.21e-4 SMART
ZnF_C2H2 280 302 2.57e-3 SMART
ZnF_C2H2 308 330 5.59e-4 SMART
ZnF_C2H2 336 358 1.79e-2 SMART
ZnF_C2H2 364 386 7.9e-4 SMART
ZnF_C2H2 392 414 5.5e-3 SMART
low complexity region 428 470 N/A INTRINSIC
ZnF_C2H2 516 538 3.63e-3 SMART
ZnF_C2H2 544 566 1.3e-4 SMART
ZnF_C2H2 572 594 5.59e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106262
SMART Domains Protein: ENSMUSP00000101869
Gene: ENSMUSG00000049728

DomainStartEndE-ValueType
ZnF_C2H2 22 44 7.67e-2 SMART
ZnF_C2H2 84 106 9.44e-2 SMART
ZnF_C2H2 112 134 3.63e-3 SMART
ZnF_C2H2 140 162 2.36e-2 SMART
ZnF_C2H2 168 190 1.98e-4 SMART
ZnF_C2H2 196 218 2.91e-2 SMART
ZnF_C2H2 224 246 1.26e-2 SMART
ZnF_C2H2 252 274 5.21e-4 SMART
ZnF_C2H2 280 302 2.57e-3 SMART
ZnF_C2H2 308 330 5.59e-4 SMART
ZnF_C2H2 336 358 1.79e-2 SMART
ZnF_C2H2 364 386 7.9e-4 SMART
ZnF_C2H2 392 414 5.5e-3 SMART
low complexity region 428 470 N/A INTRINSIC
ZnF_C2H2 516 538 3.63e-3 SMART
ZnF_C2H2 544 566 1.3e-4 SMART
ZnF_C2H2 572 594 5.59e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106263
SMART Domains Protein: ENSMUSP00000101870
Gene: ENSMUSG00000049728

DomainStartEndE-ValueType
ZnF_C2H2 22 44 7.67e-2 SMART
ZnF_C2H2 84 106 9.44e-2 SMART
ZnF_C2H2 112 134 3.63e-3 SMART
ZnF_C2H2 140 162 2.36e-2 SMART
ZnF_C2H2 168 190 1.98e-4 SMART
ZnF_C2H2 196 218 2.91e-2 SMART
ZnF_C2H2 224 246 1.26e-2 SMART
ZnF_C2H2 252 274 5.21e-4 SMART
ZnF_C2H2 280 302 2.57e-3 SMART
ZnF_C2H2 308 330 5.59e-4 SMART
ZnF_C2H2 336 358 1.79e-2 SMART
ZnF_C2H2 364 386 7.9e-4 SMART
ZnF_C2H2 392 414 5.5e-3 SMART
low complexity region 428 470 N/A INTRINSIC
ZnF_C2H2 516 538 3.63e-3 SMART
ZnF_C2H2 544 566 1.3e-4 SMART
ZnF_C2H2 572 594 5.59e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000131000
AA Change: R512L

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115499
Gene: ENSMUSG00000049739
AA Change: R512L

DomainStartEndE-ValueType
ZnF_C2H2 8 31 1.36e-2 SMART
ZnF_C2H2 67 89 5.29e-5 SMART
ZnF_C2H2 231 253 3.21e-4 SMART
ZnF_C2H2 258 280 9.58e-3 SMART
ZnF_C2H2 286 308 2.24e-3 SMART
low complexity region 345 362 N/A INTRINSIC
ZnF_C2H2 366 388 5.42e-2 SMART
ZnF_C2H2 393 415 8.34e-3 SMART
ZnF_C2H2 457 479 5.9e-3 SMART
ZnF_C2H2 484 506 4.87e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000144721
SMART Domains Protein: ENSMUSP00000116730
Gene: ENSMUSG00000049728

DomainStartEndE-ValueType
ZnF_C2H2 22 44 7.67e-2 SMART
ZnF_C2H2 84 106 9.44e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205364
Predicted Effect possibly damaging
Transcript: ENSMUST00000206340
AA Change: R292L

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.2611 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 99% (75/76)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700027J19Rik T A 7: 4,151,396 H131L probably benign Het
1700123L14Rik A G 6: 96,164,812 M417T probably benign Het
4931408C20Rik A T 1: 26,684,430 H556Q possibly damaging Het
5730409E04Rik A G 4: 126,612,311 K211E probably damaging Het
Acot7 A G 4: 152,206,828 I84V possibly damaging Het
Ankrd44 A G 1: 54,828,622 V34A probably benign Het
Atp4b A T 8: 13,393,489 M63K probably damaging Het
Atr T A 9: 95,936,463 I2163K probably damaging Het
Azgp1 A T 5: 137,985,164 R34* probably null Het
Ccdc152 T G 15: 3,298,121 K58T probably damaging Het
Ccdc88b T A 19: 6,850,469 Q912L probably benign Het
Chd7 G A 4: 8,844,675 E1595K probably damaging Het
Col11a1 G A 3: 114,131,641 G41D probably damaging Het
Cyp2b23 C T 7: 26,686,418 V5I probably benign Het
D430041D05Rik A G 2: 104,255,570 V22A possibly damaging Het
Ddi1 T C 9: 6,266,012 Y119C probably benign Het
Dysf T C 6: 84,106,941 L785P probably damaging Het
Eqtn T A 4: 94,928,350 T69S possibly damaging Het
F11 T A 8: 45,241,580 K581N probably damaging Het
Gli2 G A 1: 118,854,560 P172S probably damaging Het
Gm10093 A G 17: 78,492,108 D176G probably damaging Het
Gm7579 G T 7: 142,211,866 C3F unknown Het
Grin2a A G 16: 9,663,330 V501A possibly damaging Het
Grk4 G A 5: 34,674,557 D57N probably damaging Het
Gsdma A T 11: 98,666,493 D86V probably damaging Het
Gsx1 A G 5: 147,189,928 E187G probably damaging Het
Inpp5k T A 11: 75,633,481 F75L probably benign Het
Itpr1 T C 6: 108,349,659 V114A possibly damaging Het
Izumo3 A T 4: 92,144,740 C130S probably damaging Het
Mei4 G A 9: 81,927,586 E241K possibly damaging Het
Mocs2 T C 13: 114,824,584 V39A probably benign Het
Mroh2b G A 15: 4,945,090 R1184H probably benign Het
Msh3 T C 13: 92,300,275 Q509R probably null Het
Myh8 T C 11: 67,301,671 W1459R probably damaging Het
Mypop T A 7: 19,000,993 probably benign Het
Ndc1 C A 4: 107,368,096 T3K probably damaging Het
Nf1 A C 11: 79,440,923 M695L probably benign Het
Nutm2 C A 13: 50,469,919 D217E possibly damaging Het
Olfr1484 A G 19: 13,585,630 T109A probably benign Het
Olfr243 T C 7: 103,716,651 I19T probably damaging Het
Pde6c C A 19: 38,141,492 D283E probably damaging Het
Phldb2 A G 16: 45,770,779 probably benign Het
Pigt G C 2: 164,507,499 R574P probably damaging Het
Pkd1 T C 17: 24,577,526 I2354T possibly damaging Het
Prdm15 T C 16: 97,839,306 E27G probably damaging Het
Ptpn14 A G 1: 189,865,512 I1140V probably benign Het
Rdx T C 9: 52,063,591 V9A probably damaging Het
Rfx7 T C 9: 72,611,789 S258P probably damaging Het
Rnf17 G T 14: 56,493,365 G1209C probably damaging Het
S1pr4 C T 10: 81,499,391 probably null Het
Scml2 G T X: 161,231,446 E566D possibly damaging Het
Serpinb1b T A 13: 33,093,663 V293E possibly damaging Het
Serpinb9b T C 13: 33,038,129 probably null Het
Sez6l A C 5: 112,475,049 I212S probably damaging Het
Son T C 16: 91,657,664 S1100P probably damaging Het
Spag9 G A 11: 94,048,539 R98H probably damaging Het
St3gal5 T C 6: 72,142,288 L128P probably benign Het
Stra6 A T 9: 58,151,883 M510L probably benign Het
Stxbp5l A G 16: 37,208,111 V530A probably benign Het
Tatdn1 A G 15: 58,921,190 probably benign Het
Tbc1d8 A G 1: 39,391,125 S466P probably benign Het
Tmem199 A T 11: 78,508,326 M175K possibly damaging Het
Trmt12 A G 15: 58,872,915 E54G probably benign Het
Usp37 G T 1: 74,493,004 Q77K possibly damaging Het
Vezf1 A G 11: 88,076,299 I301V possibly damaging Het
Vmn1r34 T G 6: 66,636,948 M269L probably benign Het
Wdr93 C A 7: 79,771,509 probably null Het
Wnk2 T C 13: 49,060,894 D644G probably damaging Het
Zc3h13 C T 14: 75,337,483 R1591* probably null Het
Zfp131 G A 13: 119,768,780 L371F probably damaging Het
Zfp180 T A 7: 24,104,624 V156D probably benign Het
Zscan12 C A 13: 21,366,643 T144K probably benign Het
Other mutations in Zfp646
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Zfp646 APN 7 127879130 missense possibly damaging 0.91
IGL01669:Zfp646 APN 7 127878965 missense probably benign
IGL02571:Zfp646 APN 7 127879412 missense probably damaging 1.00
R0009:Zfp646 UTSW 7 127880731 missense probably damaging 0.96
R0084:Zfp646 UTSW 7 127881304 missense possibly damaging 0.86
R0140:Zfp646 UTSW 7 127883506 missense probably benign 0.41
R0394:Zfp646 UTSW 7 127883262 missense possibly damaging 0.85
R0571:Zfp646 UTSW 7 127881966 missense probably damaging 0.96
R0924:Zfp646 UTSW 7 127883810 nonsense probably null
R0930:Zfp646 UTSW 7 127883810 nonsense probably null
R1219:Zfp646 UTSW 7 127883120 missense probably benign
R1221:Zfp646 UTSW 7 127883120 missense probably benign
R1351:Zfp646 UTSW 7 127883511 missense probably benign
R1370:Zfp646 UTSW 7 127879864 missense probably damaging 1.00
R1503:Zfp646 UTSW 7 127880136 missense probably damaging 1.00
R1817:Zfp646 UTSW 7 127883120 missense probably benign
R1818:Zfp646 UTSW 7 127883120 missense probably benign
R1819:Zfp646 UTSW 7 127883120 missense probably benign
R1838:Zfp646 UTSW 7 127879739 missense probably damaging 1.00
R1870:Zfp646 UTSW 7 127883849 missense possibly damaging 0.85
R2100:Zfp646 UTSW 7 127882187 missense probably damaging 1.00
R2763:Zfp646 UTSW 7 127880038 nonsense probably null
R4346:Zfp646 UTSW 7 127879509 missense probably damaging 1.00
R4770:Zfp646 UTSW 7 127883477 missense possibly damaging 0.83
R4824:Zfp646 UTSW 7 127883735 missense probably benign 0.00
R4936:Zfp646 UTSW 7 127881761 missense possibly damaging 0.93
R4937:Zfp646 UTSW 7 127879182 missense probably benign 0.01
R5062:Zfp646 UTSW 7 127880499 missense probably damaging 0.99
R5424:Zfp646 UTSW 7 127882703 missense possibly damaging 0.72
R5610:Zfp646 UTSW 7 127879358 missense probably damaging 1.00
R5729:Zfp646 UTSW 7 127885454 missense probably damaging 0.99
R6112:Zfp646 UTSW 7 127879018 missense possibly damaging 0.71
R6161:Zfp646 UTSW 7 127878725 missense probably damaging 1.00
R6310:Zfp646 UTSW 7 127883907 missense probably benign 0.13
R6331:Zfp646 UTSW 7 127883681 missense probably damaging 0.99
R6436:Zfp646 UTSW 7 127879941 missense probably benign 0.00
R6814:Zfp646 UTSW 7 127883333 missense probably benign 0.17
R6872:Zfp646 UTSW 7 127883333 missense probably benign 0.17
R6903:Zfp646 UTSW 7 127880720 missense possibly damaging 0.91
R7018:Zfp646 UTSW 7 127882322 missense probably benign
R7049:Zfp646 UTSW 7 127880027 missense possibly damaging 0.93
R7121:Zfp646 UTSW 7 127879772 missense possibly damaging 0.95
R7405:Zfp646 UTSW 7 127878796 nonsense probably null
R8345:Zfp646 UTSW 7 127883910 missense probably benign 0.12
Z1177:Zfp646 UTSW 7 127880632 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CTGCTCTTACGTCAGCCGAGAATAC -3'
(R):5'- ACACACCTGTGGCACTGTCCTATC -3'

Sequencing Primer
(F):5'- CTGGACCATCGTCCCTATAAGTG -3'
(R):5'- CCTATCTGCCATTGAGGGGTTAC -3'
Posted On2014-04-24