Incidental Mutation 'R1605:Atp4b'
ID176405
Institutional Source Beutler Lab
Gene Symbol Atp4b
Ensembl Gene ENSMUSG00000031449
Gene NameATPase, H+/K+ exchanging, beta polypeptide
SynonymsH+,K+-ATPase, H,K-ATPase-Beta, H+/K+-ATPase beta
MMRRC Submission 039642-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1605 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location13386205-13396825 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13393489 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 63 (M63K)
Ref Sequence ENSEMBL: ENSMUSP00000033826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033826]
Predicted Effect probably damaging
Transcript: ENSMUST00000033826
AA Change: M63K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033826
Gene: ENSMUSG00000031449
AA Change: M63K

DomainStartEndE-ValueType
Pfam:Na_K-ATPase 7 288 5.7e-108 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211331
Meta Mutation Damage Score 0.8565 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes the beta subunit of the gastric H+, K+-ATPase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are superficially normal but have hypertrophied stomach mucosa, neutral luminal pH in the stomach, and hypergastrinemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700027J19Rik T A 7: 4,151,396 H131L probably benign Het
1700123L14Rik A G 6: 96,164,812 M417T probably benign Het
4931408C20Rik A T 1: 26,684,430 H556Q possibly damaging Het
5730409E04Rik A G 4: 126,612,311 K211E probably damaging Het
Acot7 A G 4: 152,206,828 I84V possibly damaging Het
Ankrd44 A G 1: 54,828,622 V34A probably benign Het
Atr T A 9: 95,936,463 I2163K probably damaging Het
Azgp1 A T 5: 137,985,164 R34* probably null Het
Ccdc152 T G 15: 3,298,121 K58T probably damaging Het
Ccdc88b T A 19: 6,850,469 Q912L probably benign Het
Chd7 G A 4: 8,844,675 E1595K probably damaging Het
Col11a1 G A 3: 114,131,641 G41D probably damaging Het
Cyp2b23 C T 7: 26,686,418 V5I probably benign Het
D430041D05Rik A G 2: 104,255,570 V22A possibly damaging Het
Ddi1 T C 9: 6,266,012 Y119C probably benign Het
Dysf T C 6: 84,106,941 L785P probably damaging Het
Eqtn T A 4: 94,928,350 T69S possibly damaging Het
F11 T A 8: 45,241,580 K581N probably damaging Het
Gli2 G A 1: 118,854,560 P172S probably damaging Het
Gm10093 A G 17: 78,492,108 D176G probably damaging Het
Gm7579 G T 7: 142,211,866 C3F unknown Het
Grin2a A G 16: 9,663,330 V501A possibly damaging Het
Grk4 G A 5: 34,674,557 D57N probably damaging Het
Gsdma A T 11: 98,666,493 D86V probably damaging Het
Gsx1 A G 5: 147,189,928 E187G probably damaging Het
Inpp5k T A 11: 75,633,481 F75L probably benign Het
Itpr1 T C 6: 108,349,659 V114A possibly damaging Het
Izumo3 A T 4: 92,144,740 C130S probably damaging Het
Mei4 G A 9: 81,927,586 E241K possibly damaging Het
Mocs2 T C 13: 114,824,584 V39A probably benign Het
Mroh2b G A 15: 4,945,090 R1184H probably benign Het
Msh3 T C 13: 92,300,275 Q509R probably null Het
Myh8 T C 11: 67,301,671 W1459R probably damaging Het
Mypop T A 7: 19,000,993 probably benign Het
Ndc1 C A 4: 107,368,096 T3K probably damaging Het
Nf1 A C 11: 79,440,923 M695L probably benign Het
Nutm2 C A 13: 50,469,919 D217E possibly damaging Het
Olfr1484 A G 19: 13,585,630 T109A probably benign Het
Olfr243 T C 7: 103,716,651 I19T probably damaging Het
Pde6c C A 19: 38,141,492 D283E probably damaging Het
Phldb2 A G 16: 45,770,779 probably benign Het
Pigt G C 2: 164,507,499 R574P probably damaging Het
Pkd1 T C 17: 24,577,526 I2354T possibly damaging Het
Prdm15 T C 16: 97,839,306 E27G probably damaging Het
Ptpn14 A G 1: 189,865,512 I1140V probably benign Het
Rdx T C 9: 52,063,591 V9A probably damaging Het
Rfx7 T C 9: 72,611,789 S258P probably damaging Het
Rnf17 G T 14: 56,493,365 G1209C probably damaging Het
S1pr4 C T 10: 81,499,391 probably null Het
Scml2 G T X: 161,231,446 E566D possibly damaging Het
Serpinb1b T A 13: 33,093,663 V293E possibly damaging Het
Serpinb9b T C 13: 33,038,129 probably null Het
Sez6l A C 5: 112,475,049 I212S probably damaging Het
Son T C 16: 91,657,664 S1100P probably damaging Het
Spag9 G A 11: 94,048,539 R98H probably damaging Het
St3gal5 T C 6: 72,142,288 L128P probably benign Het
Stra6 A T 9: 58,151,883 M510L probably benign Het
Stxbp5l A G 16: 37,208,111 V530A probably benign Het
Tatdn1 A G 15: 58,921,190 probably benign Het
Tbc1d8 A G 1: 39,391,125 S466P probably benign Het
Tmem199 A T 11: 78,508,326 M175K possibly damaging Het
Trmt12 A G 15: 58,872,915 E54G probably benign Het
Usp37 G T 1: 74,493,004 Q77K possibly damaging Het
Vezf1 A G 11: 88,076,299 I301V possibly damaging Het
Vmn1r34 T G 6: 66,636,948 M269L probably benign Het
Wdr93 C A 7: 79,771,509 probably null Het
Wnk2 T C 13: 49,060,894 D644G probably damaging Het
Zc3h13 C T 14: 75,337,483 R1591* probably null Het
Zfp131 G A 13: 119,768,780 L371F probably damaging Het
Zfp180 T A 7: 24,104,624 V156D probably benign Het
Zfp646 G T 7: 127,880,187 probably null Het
Zscan12 C A 13: 21,366,643 T144K probably benign Het
Other mutations in Atp4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Atp4b APN 8 13389679 missense probably damaging 1.00
IGL02596:Atp4b APN 8 13393471 missense possibly damaging 0.87
R0558:Atp4b UTSW 8 13393523 missense possibly damaging 0.62
R0829:Atp4b UTSW 8 13390098 missense probably damaging 1.00
R0963:Atp4b UTSW 8 13390014 missense probably benign 0.00
R1528:Atp4b UTSW 8 13389693 missense possibly damaging 0.78
R2022:Atp4b UTSW 8 13387477 missense possibly damaging 0.88
R3824:Atp4b UTSW 8 13393549 missense probably damaging 1.00
R3825:Atp4b UTSW 8 13393549 missense probably damaging 1.00
R4108:Atp4b UTSW 8 13396640 critical splice donor site probably null
R4400:Atp4b UTSW 8 13388810 missense probably damaging 1.00
R4606:Atp4b UTSW 8 13389998 missense probably damaging 1.00
R4681:Atp4b UTSW 8 13389700 missense probably benign 0.01
R6056:Atp4b UTSW 8 13388782 missense probably damaging 1.00
R7485:Atp4b UTSW 8 13386732 missense probably benign
R7888:Atp4b UTSW 8 13389811 missense probably damaging 0.98
R7971:Atp4b UTSW 8 13389811 missense probably damaging 0.98
Z1177:Atp4b UTSW 8 13389794 missense probably benign 0.00
Z1177:Atp4b UTSW 8 13396684 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TTCCTCTCAGGAATCTGTGGGGAC -3'
(R):5'- ACAGGGTTGTCACTAACATGCAAGG -3'

Sequencing Primer
(F):5'- ACCCCTGTCCCAGGTGTAG -3'
(R):5'- agggagtgagggtaaaggg -3'
Posted On2014-04-24