Incidental Mutation 'R1605:Rdx'
Institutional Source Beutler Lab
Gene Symbol Rdx
Ensembl Gene ENSMUSG00000032050
Gene Nameradixin
MMRRC Submission 039642-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1605 (G1)
Quality Score225
Status Validated
Chromosomal Location52047173-52088735 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52063591 bp
Amino Acid Change Valine to Alanine at position 9 (V9A)
Ref Sequence ENSEMBL: ENSMUSP00000128249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000590] [ENSMUST00000061352] [ENSMUST00000163153]
Crystal structure of the radxin FERM domain complexed with the ICAM-2 cytoplasmic peptide [X-RAY DIFFRACTION]
Crystal structure of the Radixin FERM domain complexed with the NHERF-1 C-terminal tail peptide [X-RAY DIFFRACTION]
Crystal structure of the Radixin FERM domain complexed with the NHERF-2 C-terminal tail peptide [X-RAY DIFFRACTION]
Crystal structure of the dimerized radixin FERM domain [X-RAY DIFFRACTION]
Crystal Structure Analysis of the radixin FERM domain complexed with adhesion molecule CD43 [X-RAY DIFFRACTION]
Crystal Structure Analysis of the radixin FERM domain complexed with adhesion molecule PSGL-1 [X-RAY DIFFRACTION]
Crystal structure of the Radixin FERM domain complexed with the NEP cytoplasmic tail [X-RAY DIFFRACTION]
Crystal structure of the mouse radxin FERM domain complexed with the mouse CD44 cytoplasmic peptide [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000000590
AA Change: V9A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000590
Gene: ENSMUSG00000032050
AA Change: V9A

B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
Pfam:ERM 338 583 6e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000061352
AA Change: V9A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055303
Gene: ENSMUSG00000032050
AA Change: V9A

B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
coiled coil region 300 365 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163153
AA Change: V9A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128249
Gene: ENSMUSG00000032050
AA Change: V9A

B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
Pfam:ERM 338 583 3.4e-78 PFAM
Meta Mutation Damage Score 0.5824 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Radixin is a cytoskeletal protein that may be important in linking actin to the plasma membrane. It is highly similar in sequence to both ezrin and moesin. The radixin gene has been localized by fluorescence in situ hybridization to 11q23. A truncated version representing a pseudogene (RDXP2) was assigned to Xp21.3. Another pseudogene that seemed to lack introns (RDXP1) was mapped to 11p by Southern and PCR analyses. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a targeted mutation display mild degenerative changes in the liver and hyperbilirubinemia. Adult homozygotes exhibit profound deafness, but not imbalance, associated with progressive degeneration of stereocilia of cochlear hair cells after the onset of hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700027J19Rik T A 7: 4,151,396 H131L probably benign Het
1700123L14Rik A G 6: 96,164,812 M417T probably benign Het
4931408C20Rik A T 1: 26,684,430 H556Q possibly damaging Het
5730409E04Rik A G 4: 126,612,311 K211E probably damaging Het
Acot7 A G 4: 152,206,828 I84V possibly damaging Het
Ankrd44 A G 1: 54,828,622 V34A probably benign Het
Atp4b A T 8: 13,393,489 M63K probably damaging Het
Atr T A 9: 95,936,463 I2163K probably damaging Het
Azgp1 A T 5: 137,985,164 R34* probably null Het
Ccdc152 T G 15: 3,298,121 K58T probably damaging Het
Ccdc88b T A 19: 6,850,469 Q912L probably benign Het
Chd7 G A 4: 8,844,675 E1595K probably damaging Het
Col11a1 G A 3: 114,131,641 G41D probably damaging Het
Cyp2b23 C T 7: 26,686,418 V5I probably benign Het
D430041D05Rik A G 2: 104,255,570 V22A possibly damaging Het
Ddi1 T C 9: 6,266,012 Y119C probably benign Het
Dysf T C 6: 84,106,941 L785P probably damaging Het
Eqtn T A 4: 94,928,350 T69S possibly damaging Het
F11 T A 8: 45,241,580 K581N probably damaging Het
Gli2 G A 1: 118,854,560 P172S probably damaging Het
Gm10093 A G 17: 78,492,108 D176G probably damaging Het
Gm7579 G T 7: 142,211,866 C3F unknown Het
Grin2a A G 16: 9,663,330 V501A possibly damaging Het
Grk4 G A 5: 34,674,557 D57N probably damaging Het
Gsdma A T 11: 98,666,493 D86V probably damaging Het
Gsx1 A G 5: 147,189,928 E187G probably damaging Het
Inpp5k T A 11: 75,633,481 F75L probably benign Het
Itpr1 T C 6: 108,349,659 V114A possibly damaging Het
Izumo3 A T 4: 92,144,740 C130S probably damaging Het
Mei4 G A 9: 81,927,586 E241K possibly damaging Het
Mocs2 T C 13: 114,824,584 V39A probably benign Het
Mroh2b G A 15: 4,945,090 R1184H probably benign Het
Msh3 T C 13: 92,300,275 Q509R probably null Het
Myh8 T C 11: 67,301,671 W1459R probably damaging Het
Mypop T A 7: 19,000,993 probably benign Het
Ndc1 C A 4: 107,368,096 T3K probably damaging Het
Nf1 A C 11: 79,440,923 M695L probably benign Het
Nutm2 C A 13: 50,469,919 D217E possibly damaging Het
Olfr1484 A G 19: 13,585,630 T109A probably benign Het
Olfr243 T C 7: 103,716,651 I19T probably damaging Het
Pde6c C A 19: 38,141,492 D283E probably damaging Het
Phldb2 A G 16: 45,770,779 probably benign Het
Pigt G C 2: 164,507,499 R574P probably damaging Het
Pkd1 T C 17: 24,577,526 I2354T possibly damaging Het
Prdm15 T C 16: 97,839,306 E27G probably damaging Het
Ptpn14 A G 1: 189,865,512 I1140V probably benign Het
Rfx7 T C 9: 72,611,789 S258P probably damaging Het
Rnf17 G T 14: 56,493,365 G1209C probably damaging Het
S1pr4 C T 10: 81,499,391 probably null Het
Scml2 G T X: 161,231,446 E566D possibly damaging Het
Serpinb1b T A 13: 33,093,663 V293E possibly damaging Het
Serpinb9b T C 13: 33,038,129 probably null Het
Sez6l A C 5: 112,475,049 I212S probably damaging Het
Son T C 16: 91,657,664 S1100P probably damaging Het
Spag9 G A 11: 94,048,539 R98H probably damaging Het
St3gal5 T C 6: 72,142,288 L128P probably benign Het
Stra6 A T 9: 58,151,883 M510L probably benign Het
Stxbp5l A G 16: 37,208,111 V530A probably benign Het
Tatdn1 A G 15: 58,921,190 probably benign Het
Tbc1d8 A G 1: 39,391,125 S466P probably benign Het
Tmem199 A T 11: 78,508,326 M175K possibly damaging Het
Trmt12 A G 15: 58,872,915 E54G probably benign Het
Usp37 G T 1: 74,493,004 Q77K possibly damaging Het
Vezf1 A G 11: 88,076,299 I301V possibly damaging Het
Vmn1r34 T G 6: 66,636,948 M269L probably benign Het
Wdr93 C A 7: 79,771,509 probably null Het
Wnk2 T C 13: 49,060,894 D644G probably damaging Het
Zc3h13 C T 14: 75,337,483 R1591* probably null Het
Zfp131 G A 13: 119,768,780 L371F probably damaging Het
Zfp180 T A 7: 24,104,624 V156D probably benign Het
Zfp646 G T 7: 127,880,187 probably null Het
Zscan12 C A 13: 21,366,643 T144K probably benign Het
Other mutations in Rdx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Rdx APN 9 52086346 missense probably damaging 1.00
IGL02088:Rdx APN 9 52060883 utr 5 prime probably benign
IGL02522:Rdx APN 9 52068204 missense possibly damaging 0.92
R0731:Rdx UTSW 9 52068218 missense probably benign 0.05
R0748:Rdx UTSW 9 52064860 missense possibly damaging 0.87
R0831:Rdx UTSW 9 52065817 missense probably damaging 1.00
R1688:Rdx UTSW 9 52060911 splice site probably benign
R2127:Rdx UTSW 9 52069732 missense possibly damaging 0.49
R2363:Rdx UTSW 9 52068873 missense probably damaging 1.00
R2899:Rdx UTSW 9 52068911 splice site probably benign
R4184:Rdx UTSW 9 52067380 missense probably damaging 1.00
R4569:Rdx UTSW 9 52068841 missense probably benign 0.07
R4607:Rdx UTSW 9 52068837 missense probably damaging 0.99
R4760:Rdx UTSW 9 52065874 missense probably benign 0.02
R4820:Rdx UTSW 9 52063591 missense probably damaging 1.00
R4966:Rdx UTSW 9 52075009 missense probably benign 0.00
R6707:Rdx UTSW 9 52063654 missense probably damaging 1.00
R7136:Rdx UTSW 9 52086445 missense probably damaging 1.00
R7308:Rdx UTSW 9 52068870 missense probably damaging 0.98
R7597:Rdx UTSW 9 52060896 missense possibly damaging 0.84
R7835:Rdx UTSW 9 52065788 missense probably damaging 0.98
R7923:Rdx UTSW 9 52065901 missense possibly damaging 0.93
R8055:Rdx UTSW 9 52086424 missense probably damaging 1.00
R8057:Rdx UTSW 9 52065646 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- acagtaaggagtggaaacagg -3'
Posted On2014-04-24