Incidental Mutation 'R1605:Inpp5k'
ID176417
Institutional Source Beutler Lab
Gene Symbol Inpp5k
Ensembl Gene ENSMUSG00000006127
Gene Nameinositol polyphosphate 5-phosphatase K
Synonymsputative PI-5-phosphatase, PI-5-phosphatase related, C62, Pps
MMRRC Submission 039642-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1605 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location75630988-75648871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75633481 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 75 (F75L)
Ref Sequence ENSEMBL: ENSMUSP00000006286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006286] [ENSMUST00000143219] [ENSMUST00000150857] [ENSMUST00000179521]
Predicted Effect probably benign
Transcript: ENSMUST00000006286
AA Change: F75L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000006286
Gene: ENSMUSG00000006127
AA Change: F75L

DomainStartEndE-ValueType
IPPc 30 345 1.03e-148 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129298
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136605
Predicted Effect probably benign
Transcript: ENSMUST00000143219
SMART Domains Protein: ENSMUSP00000115723
Gene: ENSMUSG00000017781

DomainStartEndE-ValueType
Pfam:IP_trans 2 255 4.7e-147 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150857
Predicted Effect probably benign
Transcript: ENSMUST00000179521
SMART Domains Protein: ENSMUSP00000137510
Gene: ENSMUSG00000017781

DomainStartEndE-ValueType
Pfam:IP_trans 2 254 3.2e-123 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 5-phosphatase activity toward polyphosphate inositol. The protein localizes to the cytosol in regions lacking actin stress fibers. It is thought that this protein may negatively regulate the actin cytoskeleton. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous disruption of this gene leads to embryonic lethality. Adult heterozygous mutant mice show normal food intake and adiposity but exhibit enhanced glucose homeostasis and insulin sensitivity, increased insulin action in skeletal muscle, and reduced diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700027J19Rik T A 7: 4,151,396 H131L probably benign Het
1700123L14Rik A G 6: 96,164,812 M417T probably benign Het
4931408C20Rik A T 1: 26,684,430 H556Q possibly damaging Het
5730409E04Rik A G 4: 126,612,311 K211E probably damaging Het
Acot7 A G 4: 152,206,828 I84V possibly damaging Het
Ankrd44 A G 1: 54,828,622 V34A probably benign Het
Atp4b A T 8: 13,393,489 M63K probably damaging Het
Atr T A 9: 95,936,463 I2163K probably damaging Het
Azgp1 A T 5: 137,985,164 R34* probably null Het
Ccdc152 T G 15: 3,298,121 K58T probably damaging Het
Ccdc88b T A 19: 6,850,469 Q912L probably benign Het
Chd7 G A 4: 8,844,675 E1595K probably damaging Het
Col11a1 G A 3: 114,131,641 G41D probably damaging Het
Cyp2b23 C T 7: 26,686,418 V5I probably benign Het
D430041D05Rik A G 2: 104,255,570 V22A possibly damaging Het
Ddi1 T C 9: 6,266,012 Y119C probably benign Het
Dysf T C 6: 84,106,941 L785P probably damaging Het
Eqtn T A 4: 94,928,350 T69S possibly damaging Het
F11 T A 8: 45,241,580 K581N probably damaging Het
Gli2 G A 1: 118,854,560 P172S probably damaging Het
Gm10093 A G 17: 78,492,108 D176G probably damaging Het
Gm7579 G T 7: 142,211,866 C3F unknown Het
Grin2a A G 16: 9,663,330 V501A possibly damaging Het
Grk4 G A 5: 34,674,557 D57N probably damaging Het
Gsdma A T 11: 98,666,493 D86V probably damaging Het
Gsx1 A G 5: 147,189,928 E187G probably damaging Het
Itpr1 T C 6: 108,349,659 V114A possibly damaging Het
Izumo3 A T 4: 92,144,740 C130S probably damaging Het
Mei4 G A 9: 81,927,586 E241K possibly damaging Het
Mocs2 T C 13: 114,824,584 V39A probably benign Het
Mroh2b G A 15: 4,945,090 R1184H probably benign Het
Msh3 T C 13: 92,300,275 Q509R probably null Het
Myh8 T C 11: 67,301,671 W1459R probably damaging Het
Mypop T A 7: 19,000,993 probably benign Het
Ndc1 C A 4: 107,368,096 T3K probably damaging Het
Nf1 A C 11: 79,440,923 M695L probably benign Het
Nutm2 C A 13: 50,469,919 D217E possibly damaging Het
Olfr1484 A G 19: 13,585,630 T109A probably benign Het
Olfr243 T C 7: 103,716,651 I19T probably damaging Het
Pde6c C A 19: 38,141,492 D283E probably damaging Het
Phldb2 A G 16: 45,770,779 probably benign Het
Pigt G C 2: 164,507,499 R574P probably damaging Het
Pkd1 T C 17: 24,577,526 I2354T possibly damaging Het
Prdm15 T C 16: 97,839,306 E27G probably damaging Het
Ptpn14 A G 1: 189,865,512 I1140V probably benign Het
Rdx T C 9: 52,063,591 V9A probably damaging Het
Rfx7 T C 9: 72,611,789 S258P probably damaging Het
Rnf17 G T 14: 56,493,365 G1209C probably damaging Het
S1pr4 C T 10: 81,499,391 probably null Het
Scml2 G T X: 161,231,446 E566D possibly damaging Het
Serpinb1b T A 13: 33,093,663 V293E possibly damaging Het
Serpinb9b T C 13: 33,038,129 probably null Het
Sez6l A C 5: 112,475,049 I212S probably damaging Het
Son T C 16: 91,657,664 S1100P probably damaging Het
Spag9 G A 11: 94,048,539 R98H probably damaging Het
St3gal5 T C 6: 72,142,288 L128P probably benign Het
Stra6 A T 9: 58,151,883 M510L probably benign Het
Stxbp5l A G 16: 37,208,111 V530A probably benign Het
Tatdn1 A G 15: 58,921,190 probably benign Het
Tbc1d8 A G 1: 39,391,125 S466P probably benign Het
Tmem199 A T 11: 78,508,326 M175K possibly damaging Het
Trmt12 A G 15: 58,872,915 E54G probably benign Het
Usp37 G T 1: 74,493,004 Q77K possibly damaging Het
Vezf1 A G 11: 88,076,299 I301V possibly damaging Het
Vmn1r34 T G 6: 66,636,948 M269L probably benign Het
Wdr93 C A 7: 79,771,509 probably null Het
Wnk2 T C 13: 49,060,894 D644G probably damaging Het
Zc3h13 C T 14: 75,337,483 R1591* probably null Het
Zfp131 G A 13: 119,768,780 L371F probably damaging Het
Zfp180 T A 7: 24,104,624 V156D probably benign Het
Zfp646 G T 7: 127,880,187 probably null Het
Zscan12 C A 13: 21,366,643 T144K probably benign Het
Other mutations in Inpp5k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Inpp5k APN 11 75646820 missense possibly damaging 0.72
IGL00470:Inpp5k APN 11 75645525 missense probably benign 0.00
IGL00529:Inpp5k APN 11 75631204 unclassified probably benign
IGL01761:Inpp5k APN 11 75647677 missense possibly damaging 0.75
IGL02532:Inpp5k APN 11 75633184 unclassified probably benign
R0081:Inpp5k UTSW 11 75631147 frame shift probably null
R0206:Inpp5k UTSW 11 75631143 missense probably benign
R0206:Inpp5k UTSW 11 75631143 missense probably benign
R0520:Inpp5k UTSW 11 75639530 nonsense probably null
R0841:Inpp5k UTSW 11 75633459 unclassified probably benign
R1145:Inpp5k UTSW 11 75633459 unclassified probably benign
R1433:Inpp5k UTSW 11 75637491 missense probably benign 0.00
R2144:Inpp5k UTSW 11 75647191 critical splice acceptor site probably null
R2145:Inpp5k UTSW 11 75647191 critical splice acceptor site probably null
R2296:Inpp5k UTSW 11 75639487 missense probably damaging 1.00
R3783:Inpp5k UTSW 11 75647686 missense probably damaging 0.99
R3784:Inpp5k UTSW 11 75647686 missense probably damaging 0.99
R3785:Inpp5k UTSW 11 75647686 missense probably damaging 0.99
R3787:Inpp5k UTSW 11 75647686 missense probably damaging 0.99
R5999:Inpp5k UTSW 11 75633100 missense probably damaging 0.99
R6337:Inpp5k UTSW 11 75646814 missense probably damaging 1.00
R6405:Inpp5k UTSW 11 75633178 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTGGAGGTCAACAGCCACACAG -3'
(R):5'- CGCTCAGACTGAGACAGCATAAGG -3'

Sequencing Primer
(F):5'- AGCCACACAGCTAGGAAAG -3'
(R):5'- TTCCAGGCAGCCAAGTGTAG -3'
Posted On2014-04-24