Incidental Mutation 'R1605:Mroh2b'
ID176434
Institutional Source Beutler Lab
Gene Symbol Mroh2b
Ensembl Gene ENSMUSG00000022155
Gene Namemaestro heat-like repeat family member 2B
Synonyms4930455B06Rik, Heatr7b2
MMRRC Submission 039642-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R1605 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location4898737-4962205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4945090 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 1184 (R1184H)
Ref Sequence ENSEMBL: ENSMUSP00000036148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045736]
Predicted Effect probably benign
Transcript: ENSMUST00000045736
AA Change: R1184H

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: R1184H

DomainStartEndE-ValueType
low complexity region 124 135 N/A INTRINSIC
low complexity region 824 842 N/A INTRINSIC
SCOP:d1gw5a_ 937 1443 7e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226849
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228458
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 99% (75/76)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700027J19Rik T A 7: 4,151,396 H131L probably benign Het
1700123L14Rik A G 6: 96,164,812 M417T probably benign Het
4931408C20Rik A T 1: 26,684,430 H556Q possibly damaging Het
5730409E04Rik A G 4: 126,612,311 K211E probably damaging Het
Acot7 A G 4: 152,206,828 I84V possibly damaging Het
Ankrd44 A G 1: 54,828,622 V34A probably benign Het
Atp4b A T 8: 13,393,489 M63K probably damaging Het
Atr T A 9: 95,936,463 I2163K probably damaging Het
Azgp1 A T 5: 137,985,164 R34* probably null Het
Ccdc152 T G 15: 3,298,121 K58T probably damaging Het
Ccdc88b T A 19: 6,850,469 Q912L probably benign Het
Chd7 G A 4: 8,844,675 E1595K probably damaging Het
Col11a1 G A 3: 114,131,641 G41D probably damaging Het
Cyp2b23 C T 7: 26,686,418 V5I probably benign Het
D430041D05Rik A G 2: 104,255,570 V22A possibly damaging Het
Ddi1 T C 9: 6,266,012 Y119C probably benign Het
Dysf T C 6: 84,106,941 L785P probably damaging Het
Eqtn T A 4: 94,928,350 T69S possibly damaging Het
F11 T A 8: 45,241,580 K581N probably damaging Het
Gli2 G A 1: 118,854,560 P172S probably damaging Het
Gm10093 A G 17: 78,492,108 D176G probably damaging Het
Gm7579 G T 7: 142,211,866 C3F unknown Het
Grin2a A G 16: 9,663,330 V501A possibly damaging Het
Grk4 G A 5: 34,674,557 D57N probably damaging Het
Gsdma A T 11: 98,666,493 D86V probably damaging Het
Gsx1 A G 5: 147,189,928 E187G probably damaging Het
Inpp5k T A 11: 75,633,481 F75L probably benign Het
Itpr1 T C 6: 108,349,659 V114A possibly damaging Het
Izumo3 A T 4: 92,144,740 C130S probably damaging Het
Mei4 G A 9: 81,927,586 E241K possibly damaging Het
Mocs2 T C 13: 114,824,584 V39A probably benign Het
Msh3 T C 13: 92,300,275 Q509R probably null Het
Myh8 T C 11: 67,301,671 W1459R probably damaging Het
Mypop T A 7: 19,000,993 probably benign Het
Ndc1 C A 4: 107,368,096 T3K probably damaging Het
Nf1 A C 11: 79,440,923 M695L probably benign Het
Nutm2 C A 13: 50,469,919 D217E possibly damaging Het
Olfr1484 A G 19: 13,585,630 T109A probably benign Het
Olfr243 T C 7: 103,716,651 I19T probably damaging Het
Pde6c C A 19: 38,141,492 D283E probably damaging Het
Phldb2 A G 16: 45,770,779 probably benign Het
Pigt G C 2: 164,507,499 R574P probably damaging Het
Pkd1 T C 17: 24,577,526 I2354T possibly damaging Het
Prdm15 T C 16: 97,839,306 E27G probably damaging Het
Ptpn14 A G 1: 189,865,512 I1140V probably benign Het
Rdx T C 9: 52,063,591 V9A probably damaging Het
Rfx7 T C 9: 72,611,789 S258P probably damaging Het
Rnf17 G T 14: 56,493,365 G1209C probably damaging Het
S1pr4 C T 10: 81,499,391 probably null Het
Scml2 G T X: 161,231,446 E566D possibly damaging Het
Serpinb1b T A 13: 33,093,663 V293E possibly damaging Het
Serpinb9b T C 13: 33,038,129 probably null Het
Sez6l A C 5: 112,475,049 I212S probably damaging Het
Son T C 16: 91,657,664 S1100P probably damaging Het
Spag9 G A 11: 94,048,539 R98H probably damaging Het
St3gal5 T C 6: 72,142,288 L128P probably benign Het
Stra6 A T 9: 58,151,883 M510L probably benign Het
Stxbp5l A G 16: 37,208,111 V530A probably benign Het
Tatdn1 A G 15: 58,921,190 probably benign Het
Tbc1d8 A G 1: 39,391,125 S466P probably benign Het
Tmem199 A T 11: 78,508,326 M175K possibly damaging Het
Trmt12 A G 15: 58,872,915 E54G probably benign Het
Usp37 G T 1: 74,493,004 Q77K possibly damaging Het
Vezf1 A G 11: 88,076,299 I301V possibly damaging Het
Vmn1r34 T G 6: 66,636,948 M269L probably benign Het
Wdr93 C A 7: 79,771,509 probably null Het
Wnk2 T C 13: 49,060,894 D644G probably damaging Het
Zc3h13 C T 14: 75,337,483 R1591* probably null Het
Zfp131 G A 13: 119,768,780 L371F probably damaging Het
Zfp180 T A 7: 24,104,624 V156D probably benign Het
Zfp646 G T 7: 127,880,187 probably null Het
Zscan12 C A 13: 21,366,643 T144K probably benign Het
Other mutations in Mroh2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Mroh2b APN 15 4899197 missense probably benign
IGL00507:Mroh2b APN 15 4962127 missense probably damaging 1.00
IGL00548:Mroh2b APN 15 4931316 missense probably benign 0.35
IGL00902:Mroh2b APN 15 4915222 missense probably damaging 1.00
IGL00944:Mroh2b APN 15 4951127 splice site probably benign
IGL00954:Mroh2b APN 15 4903054 missense probably damaging 0.99
IGL01015:Mroh2b APN 15 4941542 missense probably damaging 1.00
IGL01134:Mroh2b APN 15 4915152 missense probably benign 0.00
IGL01337:Mroh2b APN 15 4905024 missense probably benign 0.38
IGL01780:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL01919:Mroh2b APN 15 4923688 missense probably benign 0.10
IGL02069:Mroh2b APN 15 4904324 splice site probably benign
IGL02146:Mroh2b APN 15 4951294 splice site probably null
IGL02221:Mroh2b APN 15 4923641 missense probably damaging 1.00
IGL02281:Mroh2b APN 15 4952263 missense probably benign 0.04
IGL02350:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02357:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02401:Mroh2b APN 15 4900501 missense possibly damaging 0.71
IGL02427:Mroh2b APN 15 4951560 splice site probably benign
IGL02432:Mroh2b APN 15 4914186 missense probably benign
IGL02582:Mroh2b APN 15 4908515 missense probably damaging 0.98
IGL02632:Mroh2b APN 15 4931101 missense probably damaging 0.99
IGL02741:Mroh2b APN 15 4905632 missense probably benign
IGL02811:Mroh2b APN 15 4915236 missense possibly damaging 0.55
IGL02826:Mroh2b APN 15 4962148 missense probably damaging 0.99
IGL03412:Mroh2b APN 15 4944372 missense probably benign 0.14
PIT4468001:Mroh2b UTSW 15 4912812 missense probably damaging 1.00
R0024:Mroh2b UTSW 15 4925627 missense probably damaging 1.00
R0333:Mroh2b UTSW 15 4931118 missense probably damaging 1.00
R0433:Mroh2b UTSW 15 4941634 missense probably benign 0.01
R0530:Mroh2b UTSW 15 4934395 missense probably damaging 0.97
R1411:Mroh2b UTSW 15 4918317 missense probably damaging 1.00
R1457:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1472:Mroh2b UTSW 15 4948655 missense probably benign 0.00
R1525:Mroh2b UTSW 15 4951130 splice site probably null
R1584:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1657:Mroh2b UTSW 15 4931043 nonsense probably null
R1671:Mroh2b UTSW 15 4951294 splice site probably null
R1698:Mroh2b UTSW 15 4914140 missense probably benign 0.02
R2002:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R2005:Mroh2b UTSW 15 4917158 missense probably damaging 1.00
R2077:Mroh2b UTSW 15 4944966 missense probably damaging 1.00
R2179:Mroh2b UTSW 15 4921446 critical splice donor site probably null
R2183:Mroh2b UTSW 15 4918225 splice site probably null
R3713:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3714:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3747:Mroh2b UTSW 15 4952246 nonsense probably null
R3748:Mroh2b UTSW 15 4952246 nonsense probably null
R3749:Mroh2b UTSW 15 4952246 nonsense probably null
R3750:Mroh2b UTSW 15 4952246 nonsense probably null
R3792:Mroh2b UTSW 15 4923620 missense probably damaging 1.00
R3872:Mroh2b UTSW 15 4925061 nonsense probably null
R4021:Mroh2b UTSW 15 4925100 missense possibly damaging 0.75
R4329:Mroh2b UTSW 15 4931379 missense probably damaging 0.99
R4456:Mroh2b UTSW 15 4947925 missense probably benign 0.21
R4592:Mroh2b UTSW 15 4918290 missense probably damaging 1.00
R4836:Mroh2b UTSW 15 4904270 missense probably damaging 1.00
R5050:Mroh2b UTSW 15 4900450 missense possibly damaging 0.82
R5230:Mroh2b UTSW 15 4941522 missense probably benign 0.07
R5342:Mroh2b UTSW 15 4914133 nonsense probably null
R5353:Mroh2b UTSW 15 4917178 missense probably damaging 1.00
R5368:Mroh2b UTSW 15 4905572 missense probably damaging 1.00
R5424:Mroh2b UTSW 15 4941612 missense probably damaging 0.98
R5484:Mroh2b UTSW 15 4908981 missense possibly damaging 0.92
R5999:Mroh2b UTSW 15 4912884 splice site probably null
R6046:Mroh2b UTSW 15 4951281 missense probably benign 0.01
R6081:Mroh2b UTSW 15 4944377 missense probably damaging 1.00
R6162:Mroh2b UTSW 15 4915225 missense probably damaging 1.00
R6165:Mroh2b UTSW 15 4918350 missense probably benign 0.23
R6240:Mroh2b UTSW 15 4934644 missense probably benign 0.38
R6487:Mroh2b UTSW 15 4947239 missense probably damaging 1.00
R6539:Mroh2b UTSW 15 4905574 missense probably damaging 1.00
R6616:Mroh2b UTSW 15 4953282 missense probably benign 0.36
R6663:Mroh2b UTSW 15 4947935 missense probably benign 0.21
R6820:Mroh2b UTSW 15 4953274 missense probably damaging 1.00
R6900:Mroh2b UTSW 15 4908987 missense probably benign 0.00
R6990:Mroh2b UTSW 15 4912802 missense possibly damaging 0.55
R7067:Mroh2b UTSW 15 4900504 missense probably benign 0.35
R7092:Mroh2b UTSW 15 4934678 missense possibly damaging 0.92
R7102:Mroh2b UTSW 15 4948003 missense probably benign 0.06
R7264:Mroh2b UTSW 15 4921362 missense possibly damaging 0.81
R7436:Mroh2b UTSW 15 4941554 missense probably benign 0.21
R7462:Mroh2b UTSW 15 4908627 missense probably damaging 1.00
R7529:Mroh2b UTSW 15 4949009 missense probably damaging 1.00
R7575:Mroh2b UTSW 15 4934605 missense probably damaging 1.00
R7579:Mroh2b UTSW 15 4931061 missense probably benign 0.09
R7605:Mroh2b UTSW 15 4945023 missense probably damaging 1.00
R7624:Mroh2b UTSW 15 4917131 missense probably damaging 1.00
R7797:Mroh2b UTSW 15 4949105 missense probably benign 0.36
R7848:Mroh2b UTSW 15 4938379 nonsense probably null
R7952:Mroh2b UTSW 15 4951211 missense probably damaging 1.00
R7995:Mroh2b UTSW 15 4921357 nonsense probably null
R8088:Mroh2b UTSW 15 4900503 missense possibly damaging 0.57
R8207:Mroh2b UTSW 15 4938410 missense possibly damaging 0.95
R8242:Mroh2b UTSW 15 4909040 missense probably benign 0.04
R8248:Mroh2b UTSW 15 4931104 missense probably benign 0.40
R8258:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8259:Mroh2b UTSW 15 4911909 missense probably benign 0.01
R8304:Mroh2b UTSW 15 4925637 missense probably damaging 0.99
R8316:Mroh2b UTSW 15 4951264 nonsense probably null
R8345:Mroh2b UTSW 15 4944326 missense probably benign 0.09
R8507:Mroh2b UTSW 15 4949090 missense probably damaging 1.00
X0067:Mroh2b UTSW 15 4951591 missense possibly damaging 0.90
Z1177:Mroh2b UTSW 15 4905005 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTAAGAAACGCAGCCTGTTGAG -3'
(R):5'- GTCACGGTTAAAGGATGCCAAAGC -3'

Sequencing Primer
(F):5'- CAAGCTTCTGTAACAACCTAGTGG -3'
(R):5'- GATGCCAAAGCCTTGTTTGTTC -3'
Posted On2014-04-24