Incidental Mutation 'R1606:Slc35b4'
ID176472
Institutional Source Beutler Lab
Gene Symbol Slc35b4
Ensembl Gene ENSMUSG00000018999
Gene Namesolute carrier family 35, member B4
Synonyms4930474D06Rik
MMRRC Submission 039643-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1606 (G1)
Quality Score200
Status Not validated
Chromosome6
Chromosomal Location34153380-34177111 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 34158388 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 330 (K330*)
Ref Sequence ENSEMBL: ENSMUSP00000019143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019143] [ENSMUST00000138250]
Predicted Effect probably null
Transcript: ENSMUST00000019143
AA Change: K330*
SMART Domains Protein: ENSMUSP00000019143
Gene: ENSMUSG00000018999
AA Change: K330*

DomainStartEndE-ValueType
Pfam:UAA 2 314 1.7e-120 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126498
Predicted Effect probably benign
Transcript: ENSMUST00000138250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146514
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glycosyltransferases, such as SLC35B4, transport nucleotide sugars from the cytoplasm where they are synthesized, to the Golgi apparatus where they are utilized in the synthesis of glycoproteins, glycolipids, and proteoglycans (Ashikov et al., 2005 [PubMed 15911612]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G A 3: 36,942,399 D1087N probably damaging Het
Abcc2 A G 19: 43,836,652 D1459G probably damaging Het
Adhfe1 G A 1: 9,553,473 probably null Het
Adsl C T 15: 80,952,224 Q61* probably null Het
Arhgap26 T A 18: 39,296,872 C214S probably damaging Het
Armc8 A T 9: 99,537,729 N9K probably damaging Het
Asxl1 A G 2: 153,400,455 D975G probably damaging Het
Atp8b3 T C 10: 80,532,578 E187G probably damaging Het
Cdcp2 T C 4: 107,102,513 S42P probably damaging Het
Chek1 A G 9: 36,719,524 L198P probably damaging Het
Dlc1 A G 8: 36,850,252 V423A probably benign Het
Dpy19l2 A G 9: 24,581,215 S696P probably benign Het
Echdc3 A T 2: 6,195,627 C183S possibly damaging Het
Exph5 A C 9: 53,374,295 D892A probably benign Het
Fam120b T A 17: 15,401,811 I17K possibly damaging Het
Fbln5 C T 12: 101,765,198 D246N probably benign Het
Fbxo15 A C 18: 84,962,620 K195T possibly damaging Het
Fzd1 C A 5: 4,757,514 E23* probably null Het
Gas2l1 C A 11: 5,064,434 A9S probably damaging Het
Gcc2 C T 10: 58,269,448 L69F probably damaging Het
Ggt6 C T 11: 72,437,733 A353V possibly damaging Het
Gm340 T G 19: 41,585,074 M756R probably benign Het
Gphn T A 12: 78,683,883 V764E probably damaging Het
Grid1 A T 14: 35,445,965 Y482F probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Ifit1bl1 C T 19: 34,594,044 V338M probably benign Het
Klhl14 T A 18: 21,565,532 Q408L possibly damaging Het
Lacc1 T A 14: 77,029,641 Q394L probably benign Het
Lipe A G 7: 25,388,144 F477L probably damaging Het
Lrig2 A G 3: 104,480,107 probably null Het
Megf8 T A 7: 25,358,695 H2131Q probably damaging Het
Nek1 A G 8: 61,124,276 D1097G possibly damaging Het
Nhlrc3 A T 3: 53,458,657 Y138* probably null Het
Nudcd2 T A 11: 40,736,007 probably null Het
Numb T C 12: 83,801,010 probably null Het
Olfr871 T G 9: 20,212,946 L199R probably benign Het
Pacrg G A 17: 10,839,838 Q11* probably null Het
Ppp1r37 A T 7: 19,534,999 M192K probably damaging Het
Prmt8 T A 6: 127,689,836 K392* probably null Het
Rab28 A T 5: 41,698,452 W67R probably damaging Het
Rad21l C T 2: 151,654,686 C365Y probably damaging Het
Rbm17 A T 2: 11,595,397 F147I probably benign Het
Rbm46 A C 3: 82,864,541 F256V probably damaging Het
Rcc1 A T 4: 132,334,776 probably null Het
Rnf217 G T 10: 31,534,811 T296N possibly damaging Het
Rnmt A G 18: 68,311,653 D231G possibly damaging Het
Rph3al C T 11: 75,906,541 V110I probably damaging Het
Rxfp2 T C 5: 150,059,897 M289T probably benign Het
Sash1 T C 10: 8,729,957 R890G probably benign Het
Sf3b2 A T 19: 5,287,998 D245E probably benign Het
Skint9 A T 4: 112,389,201 V238E probably benign Het
Slc26a8 T A 17: 28,638,481 D896V possibly damaging Het
Slco1a4 G T 6: 141,839,611 H84Q probably damaging Het
Sptbn2 G T 19: 4,750,242 probably null Het
St6galnac3 A T 3: 153,206,668 D227E probably benign Het
Tek G A 4: 94,849,767 D685N probably damaging Het
Trf G T 9: 103,225,136 probably null Het
Trpm5 T A 7: 143,085,171 K288* probably null Het
Ttn C T 2: 76,737,012 V27846I probably damaging Het
Tyr A T 7: 87,437,971 D444E probably benign Het
Ucp1 C A 8: 83,295,304 A255E probably damaging Het
Ush2a A G 1: 188,759,766 D3084G probably benign Het
Yeats4 T C 10: 117,217,439 Y139C probably damaging Het
Zbtb6 A G 2: 37,429,118 V266A probably benign Het
Zfp784 A T 7: 5,035,775 N261K possibly damaging Het
Other mutations in Slc35b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01646:Slc35b4 APN 6 34158429 missense probably benign 0.03
IGL01667:Slc35b4 APN 6 34167675 missense possibly damaging 0.81
IGL01670:Slc35b4 APN 6 34170549 missense probably benign 0.00
IGL02015:Slc35b4 APN 6 34170548 missense probably damaging 1.00
IGL02710:Slc35b4 APN 6 34158541 missense probably benign 0.02
IGL03051:Slc35b4 APN 6 34160471 critical splice donor site probably null
R0008:Slc35b4 UTSW 6 34158517 missense probably damaging 1.00
R0008:Slc35b4 UTSW 6 34158517 missense probably damaging 1.00
R1052:Slc35b4 UTSW 6 34161684 missense probably damaging 1.00
R1304:Slc35b4 UTSW 6 34163365 nonsense probably null
R1713:Slc35b4 UTSW 6 34170549 missense probably benign 0.00
R1872:Slc35b4 UTSW 6 34158505 nonsense probably null
R5539:Slc35b4 UTSW 6 34176802 missense probably damaging 0.99
R6954:Slc35b4 UTSW 6 34158621 missense probably benign 0.02
R7339:Slc35b4 UTSW 6 34167656 missense probably damaging 1.00
R7560:Slc35b4 UTSW 6 34163361 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCGGTAGCAACAAGTGCGACACAG -3'
(R):5'- CGGGGTGTGTTCATCCTTACAACAG -3'

Sequencing Primer
(F):5'- GCTCTGAGACTTGGAATTCAAC -3'
(R):5'- GTTCATCCTTACAACAGAGTGTACC -3'
Posted On2014-04-24