Incidental Mutation 'R1606:Nek1'
ID176485
Institutional Source Beutler Lab
Gene Symbol Nek1
Ensembl Gene ENSMUSG00000031644
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 1
Synonymskidney, anemia and testis, kat, D8Ertd790e
MMRRC Submission 039643-MU
Accession Numbers

NCBI RefSeq: NM_175089.3; MGI: 97303

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1606 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location60993195-61131346 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61124276 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1097 (D1097G)
Ref Sequence ENSEMBL: ENSMUSP00000034065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034065] [ENSMUST00000120689] [ENSMUST00000211256] [ENSMUST00000211672]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034065
AA Change: D1097G

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034065
Gene: ENSMUSG00000031644
AA Change: D1097G

DomainStartEndE-ValueType
S_TKc 4 258 4.23e-95 SMART
Blast:S_TKc 266 303 3e-7 BLAST
low complexity region 321 337 N/A INTRINSIC
coiled coil region 372 402 N/A INTRINSIC
coiled coil region 556 592 N/A INTRINSIC
coiled coil region 647 685 N/A INTRINSIC
low complexity region 767 780 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120689
AA Change: D1125G

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113932
Gene: ENSMUSG00000031644
AA Change: D1125G

DomainStartEndE-ValueType
S_TKc 4 258 4.23e-95 SMART
Blast:S_TKc 266 303 3e-7 BLAST
low complexity region 321 337 N/A INTRINSIC
coiled coil region 372 402 N/A INTRINSIC
coiled coil region 487 510 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
coiled coil region 584 620 N/A INTRINSIC
coiled coil region 675 713 N/A INTRINSIC
low complexity region 795 808 N/A INTRINSIC
low complexity region 1158 1169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129408
Predicted Effect probably benign
Transcript: ENSMUST00000211256
AA Change: D1072G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000211672
AA Change: D1169G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype Strain: 1858030; 1858122
Lethality: D14-D365
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase involved in cell cycle regulation. The encoded protein is found in a centrosomal complex with FEZ1, a neuronal protein that plays a role in axonal development. Defects in this gene are a cause of polycystic kidney disease (PKD). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Spontaneous mutations of this gene result in pleiotropic effects that include facial dysmorphism, dwarfism, male sterility, anemia, cystic choroid plexus, a late-onset slowly progressive polycystic kidney disease, and premature death. Postnatal survival is sensitive to genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(1) Gene trapped(1) Spontaneous(2)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G A 3: 36,942,399 D1087N probably damaging Het
Abcc2 A G 19: 43,836,652 D1459G probably damaging Het
Adhfe1 G A 1: 9,553,473 probably null Het
Adsl C T 15: 80,952,224 Q61* probably null Het
Arhgap26 T A 18: 39,296,872 C214S probably damaging Het
Armc8 A T 9: 99,537,729 N9K probably damaging Het
Asxl1 A G 2: 153,400,455 D975G probably damaging Het
Atp8b3 T C 10: 80,532,578 E187G probably damaging Het
Cdcp2 T C 4: 107,102,513 S42P probably damaging Het
Chek1 A G 9: 36,719,524 L198P probably damaging Het
Dlc1 A G 8: 36,850,252 V423A probably benign Het
Dpy19l2 A G 9: 24,581,215 S696P probably benign Het
Echdc3 A T 2: 6,195,627 C183S possibly damaging Het
Exph5 A C 9: 53,374,295 D892A probably benign Het
Fam120b T A 17: 15,401,811 I17K possibly damaging Het
Fbln5 C T 12: 101,765,198 D246N probably benign Het
Fbxo15 A C 18: 84,962,620 K195T possibly damaging Het
Fzd1 C A 5: 4,757,514 E23* probably null Het
Gas2l1 C A 11: 5,064,434 A9S probably damaging Het
Gcc2 C T 10: 58,269,448 L69F probably damaging Het
Ggt6 C T 11: 72,437,733 A353V possibly damaging Het
Gm340 T G 19: 41,585,074 M756R probably benign Het
Gphn T A 12: 78,683,883 V764E probably damaging Het
Grid1 A T 14: 35,445,965 Y482F probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Ifit1bl1 C T 19: 34,594,044 V338M probably benign Het
Klhl14 T A 18: 21,565,532 Q408L possibly damaging Het
Lacc1 T A 14: 77,029,641 Q394L probably benign Het
Lipe A G 7: 25,388,144 F477L probably damaging Het
Lrig2 A G 3: 104,480,107 probably null Het
Megf8 T A 7: 25,358,695 H2131Q probably damaging Het
Nhlrc3 A T 3: 53,458,657 Y138* probably null Het
Nudcd2 T A 11: 40,736,007 probably null Het
Numb T C 12: 83,801,010 probably null Het
Olfr871 T G 9: 20,212,946 L199R probably benign Het
Pacrg G A 17: 10,839,838 Q11* probably null Het
Ppp1r37 A T 7: 19,534,999 M192K probably damaging Het
Prmt8 T A 6: 127,689,836 K392* probably null Het
Rab28 A T 5: 41,698,452 W67R probably damaging Het
Rad21l C T 2: 151,654,686 C365Y probably damaging Het
Rbm17 A T 2: 11,595,397 F147I probably benign Het
Rbm46 A C 3: 82,864,541 F256V probably damaging Het
Rcc1 A T 4: 132,334,776 probably null Het
Rnf217 G T 10: 31,534,811 T296N possibly damaging Het
Rnmt A G 18: 68,311,653 D231G possibly damaging Het
Rph3al C T 11: 75,906,541 V110I probably damaging Het
Rxfp2 T C 5: 150,059,897 M289T probably benign Het
Sash1 T C 10: 8,729,957 R890G probably benign Het
Sf3b2 A T 19: 5,287,998 D245E probably benign Het
Skint9 A T 4: 112,389,201 V238E probably benign Het
Slc26a8 T A 17: 28,638,481 D896V possibly damaging Het
Slc35b4 T A 6: 34,158,388 K330* probably null Het
Slco1a4 G T 6: 141,839,611 H84Q probably damaging Het
Sptbn2 G T 19: 4,750,242 probably null Het
St6galnac3 A T 3: 153,206,668 D227E probably benign Het
Tek G A 4: 94,849,767 D685N probably damaging Het
Trf G T 9: 103,225,136 probably null Het
Trpm5 T A 7: 143,085,171 K288* probably null Het
Ttn C T 2: 76,737,012 V27846I probably damaging Het
Tyr A T 7: 87,437,971 D444E probably benign Het
Ucp1 C A 8: 83,295,304 A255E probably damaging Het
Ush2a A G 1: 188,759,766 D3084G probably benign Het
Yeats4 T C 10: 117,217,439 Y139C probably damaging Het
Zbtb6 A G 2: 37,429,118 V266A probably benign Het
Zfp784 A T 7: 5,035,775 N261K possibly damaging Het
Other mutations in Nek1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Nek1 APN 8 61043284 missense probably benign 0.00
IGL01075:Nek1 APN 8 61124132 missense possibly damaging 0.64
IGL01122:Nek1 APN 8 61120966 missense possibly damaging 0.80
IGL01151:Nek1 APN 8 61020077 missense probably damaging 1.00
IGL01286:Nek1 APN 8 61124216 missense possibly damaging 0.64
IGL01377:Nek1 APN 8 61089456 missense probably benign
IGL01485:Nek1 APN 8 61049826 missense probably benign 0.02
IGL01688:Nek1 APN 8 61105597 nonsense probably null
IGL01806:Nek1 APN 8 61124212 missense possibly damaging 0.82
IGL02006:Nek1 APN 8 61104192 missense probably benign 0.20
IGL02304:Nek1 APN 8 61012167 missense probably damaging 1.00
IGL02659:Nek1 APN 8 61089480 missense probably benign 0.16
IGL02662:Nek1 APN 8 61104184 missense probably benign 0.00
IGL02801:Nek1 APN 8 61121061 critical splice donor site probably null
IGL02806:Nek1 APN 8 61044086 missense probably benign 0.15
IGL03037:Nek1 APN 8 61034052 missense probably benign 0.16
IGL03252:Nek1 APN 8 61072330 nonsense probably null
P0014:Nek1 UTSW 8 61071747 splice site probably benign
R0019:Nek1 UTSW 8 61089734 missense probably benign 0.01
R0403:Nek1 UTSW 8 61106855 missense probably damaging 0.99
R0464:Nek1 UTSW 8 61072273 splice site probably benign
R0726:Nek1 UTSW 8 61089592 missense probably damaging 1.00
R0761:Nek1 UTSW 8 61089455 missense probably benign
R0827:Nek1 UTSW 8 61105648 splice site probably benign
R0972:Nek1 UTSW 8 61089431 splice site probably null
R1268:Nek1 UTSW 8 61022264 missense probably damaging 1.00
R1343:Nek1 UTSW 8 61028675 missense probably damaging 1.00
R1415:Nek1 UTSW 8 61089686 missense probably benign 0.00
R1466:Nek1 UTSW 8 61125136 splice site probably benign
R1480:Nek1 UTSW 8 61124326 splice site probably null
R1526:Nek1 UTSW 8 61049941 missense probably benign 0.26
R1552:Nek1 UTSW 8 61006737 missense probably damaging 0.99
R1650:Nek1 UTSW 8 61036076 missense probably benign 0.00
R1757:Nek1 UTSW 8 61089813 splice site probably null
R1808:Nek1 UTSW 8 61016230 missense probably damaging 1.00
R1966:Nek1 UTSW 8 61016296 missense probably damaging 1.00
R2067:Nek1 UTSW 8 61007162 missense probably damaging 1.00
R2111:Nek1 UTSW 8 61124326 splice site probably null
R2113:Nek1 UTSW 8 61016293 missense probably damaging 1.00
R2143:Nek1 UTSW 8 61028696 missense probably damaging 1.00
R2255:Nek1 UTSW 8 61089773 missense probably damaging 1.00
R2422:Nek1 UTSW 8 61019901 missense probably damaging 1.00
R3848:Nek1 UTSW 8 61072315 missense probably damaging 0.99
R3849:Nek1 UTSW 8 61072315 missense probably damaging 0.99
R3850:Nek1 UTSW 8 61072315 missense probably damaging 0.99
R4418:Nek1 UTSW 8 61106864 missense probably damaging 1.00
R4526:Nek1 UTSW 8 61106944 missense probably damaging 0.99
R4533:Nek1 UTSW 8 61007213 missense possibly damaging 0.95
R4544:Nek1 UTSW 8 61016304 nonsense probably null
R4677:Nek1 UTSW 8 61028806 missense probably damaging 0.99
R4739:Nek1 UTSW 8 61098511 missense probably benign 0.32
R5068:Nek1 UTSW 8 61016296 missense probably damaging 1.00
R5421:Nek1 UTSW 8 61006677 missense possibly damaging 0.81
R5516:Nek1 UTSW 8 61089489 missense probably benign 0.03
R5855:Nek1 UTSW 8 61016272 missense probably damaging 1.00
R6125:Nek1 UTSW 8 61028701 missense probably damaging 1.00
R6267:Nek1 UTSW 8 61072309 nonsense probably null
R6292:Nek1 UTSW 8 61054736 intron probably null
R6296:Nek1 UTSW 8 61072309 nonsense probably null
R6458:Nek1 UTSW 8 61100012 missense probably benign 0.00
R6568:Nek1 UTSW 8 61106821 missense probably benign 0.00
R6629:Nek1 UTSW 8 61054333 intron probably null
R6867:Nek1 UTSW 8 61072330 missense possibly damaging 0.81
R7122:Nek1 UTSW 8 61106795 missense probably benign 0.00
R7193:Nek1 UTSW 8 61073578 missense probably damaging 0.99
R7272:Nek1 UTSW 8 61125086 missense probably benign 0.34
R7356:Nek1 UTSW 8 61120960 missense probably benign 0.02
R7368:Nek1 UTSW 8 61089707 missense probably benign 0.24
R7478:Nek1 UTSW 8 61130145 missense probably benign 0.03
R7479:Nek1 UTSW 8 61130145 missense probably benign 0.03
R7512:Nek1 UTSW 8 61130145 missense probably benign 0.03
R7715:Nek1 UTSW 8 61006760 missense probably damaging 0.98
X0028:Nek1 UTSW 8 61043258 missense probably benign 0.19
X0066:Nek1 UTSW 8 61125128 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAGTCTCCTCTGCAAATCAGCACC -3'
(R):5'- AACTGAGAAGCGGTTGGTATGTCTG -3'

Sequencing Primer
(F):5'- ATAGTTGCAGAGTACCCCTCG -3'
(R):5'- TGTGGAACACACAGTGAGC -3'
Posted On2014-04-24