Mutagenetix > Incidental Mutations

Incidental Mutation 'R1606:Exph5'

176490

Institutional Source

Beutler Lab

Gene Symbol

Exph5

Ensembl Gene

ENSMUSG00000034584

Gene Name

exophilin 5

Synonyms

Slac2b, AC079869.22gm5, B130009M24Rik, slac2-b

MMRRC Submission

039643-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1606 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

53301670-53377514 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 53374295 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 892 (D892A)

Ref Sequence

ENSEMBL: ENSMUSP00000062632 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051014]

Predicted Effect

probably benign
Transcript: ENSMUST00000051014
AA Change: D892A

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000062632
Gene: ENSMUSG00000034584
AA Change: D892A

Domain	Start	End	E-Value	Type
low complexity region	112	131	N/A	INTRINSIC
low complexity region	454	469	N/A	INTRINSIC
low complexity region	673	682	N/A	INTRINSIC
low complexity region	970	980	N/A	INTRINSIC
low complexity region	1556	1568	N/A	INTRINSIC
low complexity region	1747	1757	N/A	INTRINSIC
low complexity region	1937	1959	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.8%
20x: 91.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the synaptotagmin-like protein (Slp) family lacking a C2 domain. It contains an N-terminal synaptotagmin-like homology domain (SHD), and is a ras-related protein Rab-27B effector protein. This protein is thought to be involved in exosome secretion and intracellular vesicle trafficking. Reduced expression of this gene results in keratin filament defects. Mutations in this gene have been associated with some cases of epidermolysis bullosa, an inherited skin fragility disorder. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	G	A	3: 36,942,399	D1087N	probably damaging	Het
Abcc2	A	G	19: 43,836,652	D1459G	probably damaging	Het
Adhfe1	G	A	1: 9,553,473		probably null	Het
Adsl	C	T	15: 80,952,224	Q61*	probably null	Het
Arhgap26	T	A	18: 39,296,872	C214S	probably damaging	Het
Armc8	A	T	9: 99,537,729	N9K	probably damaging	Het
Asxl1	A	G	2: 153,400,455	D975G	probably damaging	Het
Atp8b3	T	C	10: 80,532,578	E187G	probably damaging	Het
Cdcp2	T	C	4: 107,102,513	S42P	probably damaging	Het
Chek1	A	G	9: 36,719,524	L198P	probably damaging	Het
Dlc1	A	G	8: 36,850,252	V423A	probably benign	Het
Dpy19l2	A	G	9: 24,581,215	S696P	probably benign	Het
Echdc3	A	T	2: 6,195,627	C183S	possibly damaging	Het
Fam120b	T	A	17: 15,401,811	I17K	possibly damaging	Het
Fbln5	C	T	12: 101,765,198	D246N	probably benign	Het
Fbxo15	A	C	18: 84,962,620	K195T	possibly damaging	Het
Fzd1	C	A	5: 4,757,514	E23*	probably null	Het
Gas2l1	C	A	11: 5,064,434	A9S	probably damaging	Het
Gcc2	C	T	10: 58,269,448	L69F	probably damaging	Het
Ggt6	C	T	11: 72,437,733	A353V	possibly damaging	Het
Gm340	T	G	19: 41,585,074	M756R	probably benign	Het
Gphn	T	A	12: 78,683,883	V764E	probably damaging	Het
Grid1	A	T	14: 35,445,965	Y482F	probably damaging	Het
Hlx	G	T	1: 184,731,987	A52D	probably damaging	Het
Ifit1bl1	C	T	19: 34,594,044	V338M	probably benign	Het
Klhl14	T	A	18: 21,565,532	Q408L	possibly damaging	Het
Lacc1	T	A	14: 77,029,641	Q394L	probably benign	Het
Lipe	A	G	7: 25,388,144	F477L	probably damaging	Het
Lrig2	A	G	3: 104,480,107		probably null	Het
Megf8	T	A	7: 25,358,695	H2131Q	probably damaging	Het
Nek1	A	G	8: 61,124,276	D1097G	possibly damaging	Het
Nhlrc3	A	T	3: 53,458,657	Y138*	probably null	Het
Nudcd2	T	A	11: 40,736,007		probably null	Het
Numb	T	C	12: 83,801,010		probably null	Het
Olfr871	T	G	9: 20,212,946	L199R	probably benign	Het
Pacrg	G	A	17: 10,839,838	Q11*	probably null	Het
Ppp1r37	A	T	7: 19,534,999	M192K	probably damaging	Het
Prmt8	T	A	6: 127,689,836	K392*	probably null	Het
Rab28	A	T	5: 41,698,452	W67R	probably damaging	Het
Rad21l	C	T	2: 151,654,686	C365Y	probably damaging	Het
Rbm17	A	T	2: 11,595,397	F147I	probably benign	Het
Rbm46	A	C	3: 82,864,541	F256V	probably damaging	Het
Rcc1	A	T	4: 132,334,776		probably null	Het
Rnf217	G	T	10: 31,534,811	T296N	possibly damaging	Het
Rnmt	A	G	18: 68,311,653	D231G	possibly damaging	Het
Rph3al	C	T	11: 75,906,541	V110I	probably damaging	Het
Rxfp2	T	C	5: 150,059,897	M289T	probably benign	Het
Sash1	T	C	10: 8,729,957	R890G	probably benign	Het
Sf3b2	A	T	19: 5,287,998	D245E	probably benign	Het
Skint9	A	T	4: 112,389,201	V238E	probably benign	Het
Slc26a8	T	A	17: 28,638,481	D896V	possibly damaging	Het
Slc35b4	T	A	6: 34,158,388	K330*	probably null	Het
Slco1a4	G	T	6: 141,839,611	H84Q	probably damaging	Het
Sptbn2	G	T	19: 4,750,242		probably null	Het
St6galnac3	A	T	3: 153,206,668	D227E	probably benign	Het
Tek	G	A	4: 94,849,767	D685N	probably damaging	Het
Trf	G	T	9: 103,225,136		probably null	Het
Trpm5	T	A	7: 143,085,171	K288*	probably null	Het
Ttn	C	T	2: 76,737,012	V27846I	probably damaging	Het
Tyr	A	T	7: 87,437,971	D444E	probably benign	Het
Ucp1	C	A	8: 83,295,304	A255E	probably damaging	Het
Ush2a	A	G	1: 188,759,766	D3084G	probably benign	Het
Yeats4	T	C	10: 117,217,439	Y139C	probably damaging	Het
Zbtb6	A	G	2: 37,429,118	V266A	probably benign	Het
Zfp784	A	T	7: 5,035,775	N261K	possibly damaging	Het

Other mutations in Exph5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Exph5	APN	9	53376706	nonsense	probably null
IGL01387:Exph5	APN	9	53373965	missense	possibly damaging	0.95
IGL01985:Exph5	APN	9	53376569	missense	probably damaging	0.99
IGL02122:Exph5	APN	9	53373674	missense	probably benign	0.05
IGL02156:Exph5	APN	9	53375641	missense	probably damaging	0.96
IGL02192:Exph5	APN	9	53376325	nonsense	probably null
IGL02491:Exph5	APN	9	53375043	missense	possibly damaging	0.89
PIT4802001:Exph5	UTSW	9	53374978	missense	probably damaging	0.96
R0002:Exph5	UTSW	9	53373956	missense	probably damaging	0.99
R0026:Exph5	UTSW	9	53376479	missense	probably benign	0.38
R0086:Exph5	UTSW	9	53337930	missense	possibly damaging	0.90
R0152:Exph5	UTSW	9	53353204	critical splice donor site	probably null
R0369:Exph5	UTSW	9	53373302	missense	probably benign	0.35
R0409:Exph5	UTSW	9	53374343	missense	probably benign	0.00
R0517:Exph5	UTSW	9	53372762	missense	probably benign	0.02
R0658:Exph5	UTSW	9	53377475	missense	unknown
R1739:Exph5	UTSW	9	53375588	missense	possibly damaging	0.62
R1769:Exph5	UTSW	9	53373809	missense	probably benign	0.35
R1828:Exph5	UTSW	9	53376641	missense	possibly damaging	0.79
R1862:Exph5	UTSW	9	53376248	missense	probably benign
R1993:Exph5	UTSW	9	53373635	missense	possibly damaging	0.79
R2012:Exph5	UTSW	9	53367166	missense	possibly damaging	0.49
R2044:Exph5	UTSW	9	53372679	missense	possibly damaging	0.79
R2402:Exph5	UTSW	9	53374925	nonsense	probably null
R3817:Exph5	UTSW	9	53375494	nonsense	probably null
R4771:Exph5	UTSW	9	53373665	missense	possibly damaging	0.95
R4869:Exph5	UTSW	9	53376239	missense	possibly damaging	0.73
R4926:Exph5	UTSW	9	53376625	missense	possibly damaging	0.95
R4996:Exph5	UTSW	9	53375610	missense	possibly damaging	0.79
R5254:Exph5	UTSW	9	53337930	missense	probably damaging	0.99
R5522:Exph5	UTSW	9	53374313	missense	possibly damaging	0.90
R5947:Exph5	UTSW	9	53375222	missense	probably benign	0.04
R5961:Exph5	UTSW	9	53377255	missense	probably damaging	1.00
R6093:Exph5	UTSW	9	53372617	missense	possibly damaging	0.94
R6144:Exph5	UTSW	9	53373028	missense	probably benign	0.21
R6254:Exph5	UTSW	9	53372710	missense	possibly damaging	0.81
R6279:Exph5	UTSW	9	53373946	missense	possibly damaging	0.78
R6300:Exph5	UTSW	9	53373946	missense	possibly damaging	0.78
R6485:Exph5	UTSW	9	53376691	missense	possibly damaging	0.89
R6553:Exph5	UTSW	9	53301712	start gained	probably benign
R6792:Exph5	UTSW	9	53375317	missense	possibly damaging	0.52
R7026:Exph5	UTSW	9	53340428	missense	probably benign	0.27
R7340:Exph5	UTSW	9	53377009	missense	probably damaging	0.99
R7347:Exph5	UTSW	9	53375896	missense	possibly damaging	0.79
R7352:Exph5	UTSW	9	53375722	missense	probably benign	0.00
R7520:Exph5	UTSW	9	53367214	critical splice donor site	probably null
R7521:Exph5	UTSW	9	53374077	missense	possibly damaging	0.89
R7560:Exph5	UTSW	9	53375773	missense	probably benign	0.41
R7581:Exph5	UTSW	9	53372557	missense	possibly damaging	0.90
R7726:Exph5	UTSW	9	53373175	missense	possibly damaging	0.62
R8019:Exph5	UTSW	9	53373452	missense	probably benign
X0028:Exph5	UTSW	9	53376263	missense	probably damaging	1.00
Z1177:Exph5	UTSW	9	53374213	missense	probably benign	0.44
Z1177:Exph5	UTSW	9	53377419	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCCAAGAAAGTGGAACAGCGACATC -3'
(R):5'- ACAGCATCGTGTGGAAGTGCAG -3'

Sequencing Primer
(F):5'- GTGGAACAGCGACATCTCTTC -3'
(R):5'- GTGGAAGTGCAGGACTGTC -3'

Posted On

2014-04-24