Mutagenetix > Incidental Mutations

Incidental Mutation 'R1606:Gm340'

176522

Institutional Source

Beutler Lab

Gene Symbol

Gm340

Ensembl Gene

ENSMUSG00000090673

Gene Name

predicted gene 340

Synonyms

LOC381224

MMRRC Submission

039643-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R1606 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

41582370-41586536 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 41585074 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Arginine at position 756 (M756R)

Ref Sequence

ENSEMBL: ENSMUSP00000128083 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172371]

Predicted Effect

probably benign
Transcript: ENSMUST00000172371
AA Change: M756R

PolyPhen 2 Score 0.350 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000128083
Gene: ENSMUSG00000090673
AA Change: M756R

Domain	Start	End	E-Value	Type
low complexity region	10	17	N/A	INTRINSIC
low complexity region	438	450	N/A	INTRINSIC
low complexity region	710	724	N/A	INTRINSIC
low complexity region	768	779	N/A	INTRINSIC
Pfam:DUF4553	787	1241	9.7e-179	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183602

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.8%
20x: 91.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	G	A	3: 36,942,399	D1087N	probably damaging	Het
Abcc2	A	G	19: 43,836,652	D1459G	probably damaging	Het
Adhfe1	G	A	1: 9,553,473		probably null	Het
Adsl	C	T	15: 80,952,224	Q61*	probably null	Het
Arhgap26	T	A	18: 39,296,872	C214S	probably damaging	Het
Armc8	A	T	9: 99,537,729	N9K	probably damaging	Het
Asxl1	A	G	2: 153,400,455	D975G	probably damaging	Het
Atp8b3	T	C	10: 80,532,578	E187G	probably damaging	Het
Cdcp2	T	C	4: 107,102,513	S42P	probably damaging	Het
Chek1	A	G	9: 36,719,524	L198P	probably damaging	Het
Dlc1	A	G	8: 36,850,252	V423A	probably benign	Het
Dpy19l2	A	G	9: 24,581,215	S696P	probably benign	Het
Echdc3	A	T	2: 6,195,627	C183S	possibly damaging	Het
Exph5	A	C	9: 53,374,295	D892A	probably benign	Het
Fam120b	T	A	17: 15,401,811	I17K	possibly damaging	Het
Fbln5	C	T	12: 101,765,198	D246N	probably benign	Het
Fbxo15	A	C	18: 84,962,620	K195T	possibly damaging	Het
Fzd1	C	A	5: 4,757,514	E23*	probably null	Het
Gas2l1	C	A	11: 5,064,434	A9S	probably damaging	Het
Gcc2	C	T	10: 58,269,448	L69F	probably damaging	Het
Ggt6	C	T	11: 72,437,733	A353V	possibly damaging	Het
Gphn	T	A	12: 78,683,883	V764E	probably damaging	Het
Grid1	A	T	14: 35,445,965	Y482F	probably damaging	Het
Hlx	G	T	1: 184,731,987	A52D	probably damaging	Het
Ifit1bl1	C	T	19: 34,594,044	V338M	probably benign	Het
Klhl14	T	A	18: 21,565,532	Q408L	possibly damaging	Het
Lacc1	T	A	14: 77,029,641	Q394L	probably benign	Het
Lipe	A	G	7: 25,388,144	F477L	probably damaging	Het
Lrig2	A	G	3: 104,480,107		probably null	Het
Megf8	T	A	7: 25,358,695	H2131Q	probably damaging	Het
Nek1	A	G	8: 61,124,276	D1097G	possibly damaging	Het
Nhlrc3	A	T	3: 53,458,657	Y138*	probably null	Het
Nudcd2	T	A	11: 40,736,007		probably null	Het
Numb	T	C	12: 83,801,010		probably null	Het
Olfr871	T	G	9: 20,212,946	L199R	probably benign	Het
Pacrg	G	A	17: 10,839,838	Q11*	probably null	Het
Ppp1r37	A	T	7: 19,534,999	M192K	probably damaging	Het
Prmt8	T	A	6: 127,689,836	K392*	probably null	Het
Rab28	A	T	5: 41,698,452	W67R	probably damaging	Het
Rad21l	C	T	2: 151,654,686	C365Y	probably damaging	Het
Rbm17	A	T	2: 11,595,397	F147I	probably benign	Het
Rbm46	A	C	3: 82,864,541	F256V	probably damaging	Het
Rcc1	A	T	4: 132,334,776		probably null	Het
Rnf217	G	T	10: 31,534,811	T296N	possibly damaging	Het
Rnmt	A	G	18: 68,311,653	D231G	possibly damaging	Het
Rph3al	C	T	11: 75,906,541	V110I	probably damaging	Het
Rxfp2	T	C	5: 150,059,897	M289T	probably benign	Het
Sash1	T	C	10: 8,729,957	R890G	probably benign	Het
Sf3b2	A	T	19: 5,287,998	D245E	probably benign	Het
Skint9	A	T	4: 112,389,201	V238E	probably benign	Het
Slc26a8	T	A	17: 28,638,481	D896V	possibly damaging	Het
Slc35b4	T	A	6: 34,158,388	K330*	probably null	Het
Slco1a4	G	T	6: 141,839,611	H84Q	probably damaging	Het
Sptbn2	G	T	19: 4,750,242		probably null	Het
St6galnac3	A	T	3: 153,206,668	D227E	probably benign	Het
Tek	G	A	4: 94,849,767	D685N	probably damaging	Het
Trf	G	T	9: 103,225,136		probably null	Het
Trpm5	T	A	7: 143,085,171	K288*	probably null	Het
Ttn	C	T	2: 76,737,012	V27846I	probably damaging	Het
Tyr	A	T	7: 87,437,971	D444E	probably benign	Het
Ucp1	C	A	8: 83,295,304	A255E	probably damaging	Het
Ush2a	A	G	1: 188,759,766	D3084G	probably benign	Het
Yeats4	T	C	10: 117,217,439	Y139C	probably damaging	Het
Zbtb6	A	G	2: 37,429,118	V266A	probably benign	Het
Zfp784	A	T	7: 5,035,775	N261K	possibly damaging	Het

Other mutations in Gm340

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
BB003:Gm340	UTSW	19	41582569	missense	probably benign
BB013:Gm340	UTSW	19	41582569	missense	probably benign
R0006:Gm340	UTSW	19	41584899	missense	probably benign	0.00
R0686:Gm340	UTSW	19	41582372	missense	possibly damaging	0.73
R1104:Gm340	UTSW	19	41586063	missense	probably damaging	0.99
R1278:Gm340	UTSW	19	41584683	missense	probably benign	0.07
R1833:Gm340	UTSW	19	41584948	missense	probably benign	0.00
R1905:Gm340	UTSW	19	41583574	missense	possibly damaging	0.73
R2697:Gm340	UTSW	19	41584027	missense	probably benign	0.43
R2881:Gm340	UTSW	19	41583049	missense	probably damaging	1.00
R4720:Gm340	UTSW	19	41585895	missense	probably benign	0.04
R4864:Gm340	UTSW	19	41585364	missense	probably benign
R4908:Gm340	UTSW	19	41584162	missense	probably benign	0.00
R5193:Gm340	UTSW	19	41582530	missense	probably damaging	1.00
R5215:Gm340	UTSW	19	41585932	missense	probably damaging	1.00
R5276:Gm340	UTSW	19	41585039	missense	probably damaging	0.98
R5319:Gm340	UTSW	19	41586352	missense	probably damaging	0.99
R5321:Gm340	UTSW	19	41585204	missense	probably damaging	1.00
R5432:Gm340	UTSW	19	41584603	missense	probably damaging	1.00
R5605:Gm340	UTSW	19	41582863	missense	probably damaging	1.00
R5941:Gm340	UTSW	19	41586400	missense	probably damaging	1.00
R6020:Gm340	UTSW	19	41583547	missense	possibly damaging	0.88
R6024:Gm340	UTSW	19	41583957	missense	possibly damaging	0.84
R6149:Gm340	UTSW	19	41585202	missense	probably damaging	1.00
R6260:Gm340	UTSW	19	41582370	missense	probably null	0.91
R6260:Gm340	UTSW	19	41582371	missense	possibly damaging	0.73
R6476:Gm340	UTSW	19	41583079	missense	probably benign	0.04
R7051:Gm340	UTSW	19	41585752	missense	probably benign	0.05
R7285:Gm340	UTSW	19	41584315	missense	possibly damaging	0.91
R7372:Gm340	UTSW	19	41585506	missense	probably damaging	1.00
R7762:Gm340	UTSW	19	41583667	missense	probably benign	0.02
R7833:Gm340	UTSW	19	41584585	missense	probably benign	0.02
R7926:Gm340	UTSW	19	41582569	missense	probably benign
R8164:Gm340	UTSW	19	41585410	missense	probably damaging	1.00
R8319:Gm340	UTSW	19	41582904	missense	probably damaging	1.00
R8323:Gm340	UTSW	19	41583597	missense	probably benign	0.01
R8327:Gm340	UTSW	19	41582557	missense	probably damaging	1.00
R8423:Gm340	UTSW	19	41585449	missense	possibly damaging	0.95
X0013:Gm340	UTSW	19	41584532	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCATAAAGATGATGCTGGCCTCGC -3'
(R):5'- GGAGAAAACTTTTGCACCTCCAACG -3'

Sequencing Primer
(F):5'- GCTCCATGTAGCTCATCTGG -3'
(R):5'- AAATCTCCTTCAGCTTGTCAGAC -3'

Posted On

2014-04-24