Incidental Mutation 'R1607:Ptprj'
ID176535
Institutional Source Beutler Lab
Gene Symbol Ptprj
Ensembl Gene ENSMUSG00000025314
Gene Nameprotein tyrosine phosphatase, receptor type, J
SynonymsCD148, Byp, Scc1, Scc-1, DEP-1, RPTPJ
MMRRC Submission 039644-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R1607 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location90429754-90580647 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90463320 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 380 (D380G)
Ref Sequence ENSEMBL: ENSMUSP00000107121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111493] [ENSMUST00000111495] [ENSMUST00000168621]
Predicted Effect probably benign
Transcript: ENSMUST00000111493
AA Change: D287G

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107119
Gene: ENSMUSG00000025314
AA Change: D287G

DomainStartEndE-ValueType
low complexity region 34 46 N/A INTRINSIC
FN3 47 182 3.76e-6 SMART
FN3 194 271 4.56e-5 SMART
FN3 282 357 5.32e-6 SMART
FN3 368 446 2.19e-7 SMART
FN3 455 531 5e-2 SMART
FN3 546 628 2.77e1 SMART
low complexity region 637 650 N/A INTRINSIC
Blast:PTPc 714 797 8e-26 BLAST
PTPc 867 1127 3.37e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111495
AA Change: D380G

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107121
Gene: ENSMUSG00000025314
AA Change: D380G

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
FN3 59 131 2.85e-6 SMART
FN3 140 275 3.76e-6 SMART
FN3 287 364 4.56e-5 SMART
FN3 375 450 5.32e-6 SMART
FN3 461 539 2.19e-7 SMART
FN3 548 624 5e-2 SMART
FN3 639 721 2.77e1 SMART
low complexity region 730 743 N/A INTRINSIC
Blast:PTPc 807 890 1e-25 BLAST
PTPc 960 1220 3.37e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168621
AA Change: D473G

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000129592
Gene: ENSMUSG00000025314
AA Change: D473G

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 26 94 N/A INTRINSIC
low complexity region 133 140 N/A INTRINSIC
FN3 152 224 2.85e-6 SMART
FN3 233 368 3.76e-6 SMART
FN3 380 457 4.56e-5 SMART
FN3 468 543 5.32e-6 SMART
FN3 554 632 2.19e-7 SMART
FN3 641 717 5e-2 SMART
FN3 732 814 2.77e1 SMART
low complexity region 823 836 N/A INTRINSIC
Blast:PTPc 900 983 1e-25 BLAST
PTPc 1053 1313 3.37e-133 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes, including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region containing five fibronectin type III repeats, a single transmembrane region, and a single intracytoplasmic catalytic domain, and thus represents a receptor-type PTP. This protein is present in all hematopoietic lineages, and was shown to negatively regulate T cell receptor signaling possibly through interfering with the phosphorylation of Phospholipase C Gamma 1 and Linker for Activation of T Cells. This protein can also dephosphorylate the PDGF beta receptor, and may be involved in UV-induced signal transduction. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die in utero displaying severe growth retardation and cardiovascular defects. Homozygotes for a second null allele are viable, fertile and healthy with no spontaneous tumor formation. Homozygotes for a third null allele show sterility and a block B cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C T 7: 120,251,291 P789S probably damaging Het
Adam17 T A 12: 21,334,138 probably null Het
Afdn C T 17: 13,810,501 R224W probably damaging Het
Als2 A G 1: 59,180,147 Y1215H probably damaging Het
Anks1b A T 10: 90,042,548 D73V probably damaging Het
Bpifb6 T C 2: 153,906,861 F259S probably damaging Het
Cenpv A T 11: 62,525,176 M249K probably benign Het
Ces1d C T 8: 93,186,118 V231I probably benign Het
Clasp1 G A 1: 118,504,959 V460I probably damaging Het
Cnot10 A T 9: 114,629,095 Y114* probably null Het
Cpb1 G T 3: 20,263,782 R193S probably benign Het
Ctc1 T C 11: 69,036,150 S1207P possibly damaging Het
Cttnbp2 T A 6: 18,435,433 K142M probably damaging Het
Dhrs7b T G 11: 60,851,891 D136E probably benign Het
Dnah7b T C 1: 46,290,646 S3217P probably damaging Het
Eif4g3 C T 4: 138,126,563 S480L probably benign Het
Enah A T 1: 181,917,197 probably null Het
Epx T C 11: 87,868,712 D517G probably damaging Het
Gabrg2 T A 11: 41,976,663 D43V probably damaging Het
Gdf9 A T 11: 53,437,511 E431D possibly damaging Het
Ghr T C 15: 3,320,574 D374G probably damaging Het
Gin1 A T 1: 97,786,150 I392F probably damaging Het
Greb1l A G 18: 10,529,703 E786G possibly damaging Het
Grk4 T C 5: 34,731,538 V342A probably benign Het
Hhipl2 A T 1: 183,423,524 Y135F possibly damaging Het
Insig1 C T 5: 28,071,708 R91W probably damaging Het
Kcnf1 C G 12: 17,175,732 D163H probably benign Het
Kif11 A T 19: 37,387,200 K190* probably null Het
Ldb2 T G 5: 44,473,472 E309A probably damaging Het
Lipo4 T G 19: 33,512,673 D143A probably damaging Het
Map3k6 T G 4: 133,252,473 I1261S probably damaging Het
Mtus1 C T 8: 41,015,409 V27I possibly damaging Het
Ndufaf2 C T 13: 108,091,573 V60I probably benign Het
Nup133 A G 8: 123,949,035 F48L probably benign Het
Olfr1131 T A 2: 87,628,977 N171K probably benign Het
Olfr1357 G T 10: 78,612,140 T167N probably benign Het
Olfr1362 A C 13: 21,611,764 F68L probably benign Het
Pcdhb21 A T 18: 37,515,479 N554Y probably damaging Het
Pcx A T 19: 4,603,159 D284V possibly damaging Het
Pcyt1a T C 16: 32,467,119 S203P probably damaging Het
Pdlim3 A T 8: 45,896,859 I69F probably damaging Het
Pkp4 T C 2: 59,322,554 V598A probably benign Het
Plbd1 T C 6: 136,612,306 I509V probably benign Het
Polr3b C A 10: 84,652,783 T319N probably benign Het
Ralgapa1 T G 12: 55,741,536 R587S probably damaging Het
Scn5a C A 9: 119,486,092 R1850L probably damaging Het
Ssc5d C A 7: 4,944,043 T1132K probably benign Het
Stard7 T A 2: 127,295,486 N285K possibly damaging Het
Tcp11l2 C T 10: 84,613,487 R439W probably damaging Het
Tecrl T C 5: 83,280,508 probably null Het
Tep1 A T 14: 50,824,563 L2570Q probably null Het
Tex14 A T 11: 87,554,928 D191V probably damaging Het
Tm7sf2 A G 19: 6,063,019 probably null Het
Tmem132e A G 11: 82,437,370 K408R probably benign Het
Tube1 A G 10: 39,144,766 D216G possibly damaging Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Vmn2r82 A G 10: 79,379,419 H412R possibly damaging Het
Wtip T C 7: 34,116,595 E352G probably damaging Het
Xirp2 T A 2: 67,510,295 L960* probably null Het
Zc3h11a A C 1: 133,624,687 S561A probably benign Het
Zfhx2 A T 14: 55,062,985 D2436E probably damaging Het
Zfp763 T C 17: 33,019,907 H88R probably benign Het
Other mutations in Ptprj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:Ptprj APN 2 90452144 missense probably damaging 1.00
IGL01594:Ptprj APN 2 90440795 splice site probably benign
IGL01767:Ptprj APN 2 90469574 missense probably benign 0.11
IGL01917:Ptprj APN 2 90469749 missense probably damaging 1.00
IGL01981:Ptprj APN 2 90439912 missense probably damaging 1.00
IGL02830:Ptprj APN 2 90453144 missense probably benign 0.22
IGL02955:Ptprj APN 2 90468464 critical splice acceptor site probably null
IGL03102:Ptprj APN 2 90478968 missense probably benign 0.02
IGL03150:Ptprj APN 2 90460611 missense probably damaging 0.98
IGL03210:Ptprj APN 2 90469726 missense probably benign 0.01
IGL02799:Ptprj UTSW 2 90469598 missense probably benign 0.00
R0083:Ptprj UTSW 2 90469777 intron probably null
R0108:Ptprj UTSW 2 90469777 intron probably null
R0579:Ptprj UTSW 2 90436569 critical splice acceptor site probably null
R1130:Ptprj UTSW 2 90453421 missense probably damaging 1.00
R1160:Ptprj UTSW 2 90444524 missense probably damaging 1.00
R1238:Ptprj UTSW 2 90444414 splice site probably null
R1507:Ptprj UTSW 2 90471287 missense possibly damaging 0.87
R1552:Ptprj UTSW 2 90471153 missense probably damaging 0.98
R1693:Ptprj UTSW 2 90449797 nonsense probably null
R2016:Ptprj UTSW 2 90464614 missense probably damaging 1.00
R2017:Ptprj UTSW 2 90464614 missense probably damaging 1.00
R2044:Ptprj UTSW 2 90463095 missense probably damaging 0.96
R2322:Ptprj UTSW 2 90471129 missense probably benign 0.06
R2516:Ptprj UTSW 2 90474996 splice site probably benign
R3106:Ptprj UTSW 2 90440631 missense probably damaging 1.00
R3964:Ptprj UTSW 2 90468441 missense probably benign 0.00
R4201:Ptprj UTSW 2 90463095 missense probably damaging 0.99
R4533:Ptprj UTSW 2 90439955 missense probably damaging 1.00
R4680:Ptprj UTSW 2 90460496 missense probably benign 0.00
R4738:Ptprj UTSW 2 90440643 missense probably damaging 1.00
R4983:Ptprj UTSW 2 90460532 missense probably damaging 0.98
R5137:Ptprj UTSW 2 90469648 missense possibly damaging 0.70
R5349:Ptprj UTSW 2 90471261 missense probably benign 0.00
R5369:Ptprj UTSW 2 90469641 missense probably benign 0.09
R5718:Ptprj UTSW 2 90458269 missense probably benign 0.00
R5914:Ptprj UTSW 2 90453340 missense possibly damaging 0.81
R6022:Ptprj UTSW 2 90471323 missense probably benign 0.14
R6341:Ptprj UTSW 2 90458349 missense probably benign
R6421:Ptprj UTSW 2 90471140 missense possibly damaging 0.62
R6724:Ptprj UTSW 2 90450851 missense probably benign 0.04
R6831:Ptprj UTSW 2 90460647 missense probably damaging 1.00
R6939:Ptprj UTSW 2 90459514 missense possibly damaging 0.68
R6972:Ptprj UTSW 2 90580403 missense possibly damaging 0.91
R7134:Ptprj UTSW 2 90464478 missense probably benign 0.16
R7149:Ptprj UTSW 2 90444446 missense possibly damaging 0.95
R7243:Ptprj UTSW 2 90446421 missense probably damaging 0.96
R7335:Ptprj UTSW 2 90440782 missense probably benign 0.01
R7439:Ptprj UTSW 2 90449819 missense possibly damaging 0.82
R7441:Ptprj UTSW 2 90449819 missense possibly damaging 0.82
R7498:Ptprj UTSW 2 90436565 nonsense probably null
R7571:Ptprj UTSW 2 90455186 missense probably benign 0.24
R7672:Ptprj UTSW 2 90460596 missense possibly damaging 0.49
R7849:Ptprj UTSW 2 90444460 missense probably damaging 0.98
R7932:Ptprj UTSW 2 90444460 missense probably damaging 0.98
RF013:Ptprj UTSW 2 90471170 nonsense probably null
Z1177:Ptprj UTSW 2 90460569 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCCATTCACTGTACTGGACAGCC -3'
(R):5'- CGCCTTACATTATGGACGTGGAGAC -3'

Sequencing Primer
(F):5'- GGTCCTCGTGGAATTATCTCAAAATG -3'
(R):5'- attatggacgtggagacCATGC -3'
Posted On2014-04-24