Incidental Mutation 'R1607:Map3k6'
ID 176540
Institutional Source Beutler Lab
Gene Symbol Map3k6
Ensembl Gene ENSMUSG00000028862
Gene Name mitogen-activated protein kinase kinase kinase 6
Synonyms Ask2, MAPKKK6, MEKK6
MMRRC Submission 039644-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.393) question?
Stock # R1607 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 133240818-133252929 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 133252473 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 1261 (I1261S)
Ref Sequence ENSEMBL: ENSMUSP00000030677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030674] [ENSMUST00000030677] [ENSMUST00000105908]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000030674
SMART Domains Protein: ENSMUSP00000030674
Gene: ENSMUSG00000028860

DomainStartEndE-ValueType
PDB:3BC1|F 40 92 2e-9 PDB
low complexity region 169 183 N/A INTRINSIC
low complexity region 235 262 N/A INTRINSIC
C2 288 389 2.36e-17 SMART
C2 429 532 6.96e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000030677
AA Change: I1261S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030677
Gene: ENSMUSG00000028862
AA Change: I1261S

DomainStartEndE-ValueType
low complexity region 98 109 N/A INTRINSIC
Pfam:DUF4071 130 508 2.3e-150 PFAM
S_TKc 649 907 3.49e-87 SMART
low complexity region 925 940 N/A INTRINSIC
low complexity region 947 960 N/A INTRINSIC
low complexity region 975 990 N/A INTRINSIC
low complexity region 1130 1146 N/A INTRINSIC
coiled coil region 1164 1195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105908
SMART Domains Protein: ENSMUSP00000101528
Gene: ENSMUSG00000028860

DomainStartEndE-ValueType
PDB:3BC1|F 40 92 2e-9 PDB
low complexity region 157 171 N/A INTRINSIC
low complexity region 223 250 N/A INTRINSIC
C2 276 359 3.15e-4 SMART
C2 364 467 6.96e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154911
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase that forms a component of protein kinase-mediated signal transduction cascades. The encoded kinase participates in the regulation of vascular endothelial growth factor (VEGF) expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous and heterozygous null mice display an increased incidence of chemically induced skin tumors and homozygous mice also show resistance to induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C T 7: 120,251,291 P789S probably damaging Het
Adam17 T A 12: 21,334,138 probably null Het
Afdn C T 17: 13,810,501 R224W probably damaging Het
Als2 A G 1: 59,180,147 Y1215H probably damaging Het
Anks1b A T 10: 90,042,548 D73V probably damaging Het
Bpifb6 T C 2: 153,906,861 F259S probably damaging Het
Cenpv A T 11: 62,525,176 M249K probably benign Het
Ces1d C T 8: 93,186,118 V231I probably benign Het
Clasp1 G A 1: 118,504,959 V460I probably damaging Het
Cnot10 A T 9: 114,629,095 Y114* probably null Het
Cpb1 G T 3: 20,263,782 R193S probably benign Het
Ctc1 T C 11: 69,036,150 S1207P possibly damaging Het
Cttnbp2 T A 6: 18,435,433 K142M probably damaging Het
Dhrs7b T G 11: 60,851,891 D136E probably benign Het
Dnah7b T C 1: 46,290,646 S3217P probably damaging Het
Eif4g3 C T 4: 138,126,563 S480L probably benign Het
Enah A T 1: 181,917,197 probably null Het
Epx T C 11: 87,868,712 D517G probably damaging Het
Gabrg2 T A 11: 41,976,663 D43V probably damaging Het
Gdf9 A T 11: 53,437,511 E431D possibly damaging Het
Ghr T C 15: 3,320,574 D374G probably damaging Het
Gin1 A T 1: 97,786,150 I392F probably damaging Het
Greb1l A G 18: 10,529,703 E786G possibly damaging Het
Grk4 T C 5: 34,731,538 V342A probably benign Het
Hhipl2 A T 1: 183,423,524 Y135F possibly damaging Het
Insig1 C T 5: 28,071,708 R91W probably damaging Het
Kcnf1 C G 12: 17,175,732 D163H probably benign Het
Kif11 A T 19: 37,387,200 K190* probably null Het
Ldb2 T G 5: 44,473,472 E309A probably damaging Het
Lipo4 T G 19: 33,512,673 D143A probably damaging Het
Mtus1 C T 8: 41,015,409 V27I possibly damaging Het
Ndufaf2 C T 13: 108,091,573 V60I probably benign Het
Nup133 A G 8: 123,949,035 F48L probably benign Het
Olfr1131 T A 2: 87,628,977 N171K probably benign Het
Olfr1357 G T 10: 78,612,140 T167N probably benign Het
Olfr1362 A C 13: 21,611,764 F68L probably benign Het
Pcdhb21 A T 18: 37,515,479 N554Y probably damaging Het
Pcx A T 19: 4,603,159 D284V possibly damaging Het
Pcyt1a T C 16: 32,467,119 S203P probably damaging Het
Pdlim3 A T 8: 45,896,859 I69F probably damaging Het
Pkp4 T C 2: 59,322,554 V598A probably benign Het
Plbd1 T C 6: 136,612,306 I509V probably benign Het
Polr3b C A 10: 84,652,783 T319N probably benign Het
Ptprj T C 2: 90,463,320 D380G probably benign Het
Ralgapa1 T G 12: 55,741,536 R587S probably damaging Het
Scn5a C A 9: 119,486,092 R1850L probably damaging Het
Ssc5d C A 7: 4,944,043 T1132K probably benign Het
Stard7 T A 2: 127,295,486 N285K possibly damaging Het
Tcp11l2 C T 10: 84,613,487 R439W probably damaging Het
Tecrl T C 5: 83,280,508 probably null Het
Tep1 A T 14: 50,824,563 L2570Q probably null Het
Tex14 A T 11: 87,554,928 D191V probably damaging Het
Tm7sf2 A G 19: 6,063,019 probably null Het
Tmem132e A G 11: 82,437,370 K408R probably benign Het
Tube1 A G 10: 39,144,766 D216G possibly damaging Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Vmn2r82 A G 10: 79,379,419 H412R possibly damaging Het
Wtip T C 7: 34,116,595 E352G probably damaging Het
Xirp2 T A 2: 67,510,295 L960* probably null Het
Zc3h11a A C 1: 133,624,687 S561A probably benign Het
Zfhx2 A T 14: 55,062,985 D2436E probably damaging Het
Zfp763 T C 17: 33,019,907 H88R probably benign Het
Other mutations in Map3k6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Map3k6 APN 4 133243044 splice site probably benign
IGL01060:Map3k6 APN 4 133247302 splice site probably null
IGL01116:Map3k6 APN 4 133247128 missense probably damaging 0.98
IGL01341:Map3k6 APN 4 133248060 missense possibly damaging 0.67
IGL02383:Map3k6 APN 4 133246621 splice site probably null
IGL03090:Map3k6 APN 4 133243366 missense probably benign 0.05
IGL03096:Map3k6 APN 4 133251345 nonsense probably null
IGL03149:Map3k6 APN 4 133249688 missense probably damaging 1.00
R0110:Map3k6 UTSW 4 133243794 missense probably damaging 1.00
R0142:Map3k6 UTSW 4 133250946 missense probably benign
R0189:Map3k6 UTSW 4 133246941 missense possibly damaging 0.46
R0368:Map3k6 UTSW 4 133252659 missense probably benign 0.23
R0417:Map3k6 UTSW 4 133248082 nonsense probably null
R0595:Map3k6 UTSW 4 133241263 missense probably damaging 0.98
R0597:Map3k6 UTSW 4 133245552 missense possibly damaging 0.46
R0699:Map3k6 UTSW 4 133248126 missense probably damaging 1.00
R1099:Map3k6 UTSW 4 133247128 missense probably damaging 1.00
R1113:Map3k6 UTSW 4 133245815 missense probably damaging 1.00
R1308:Map3k6 UTSW 4 133245815 missense probably damaging 1.00
R2217:Map3k6 UTSW 4 133246672 missense possibly damaging 0.46
R3734:Map3k6 UTSW 4 133248396 missense possibly damaging 0.79
R3735:Map3k6 UTSW 4 133246372 missense probably benign 0.21
R3743:Map3k6 UTSW 4 133245073 missense probably benign 0.26
R4244:Map3k6 UTSW 4 133251947 missense possibly damaging 0.65
R4245:Map3k6 UTSW 4 133251947 missense possibly damaging 0.65
R4465:Map3k6 UTSW 4 133246333 missense possibly damaging 0.66
R4482:Map3k6 UTSW 4 133243399 missense probably benign 0.00
R4827:Map3k6 UTSW 4 133248849 missense possibly damaging 0.92
R5092:Map3k6 UTSW 4 133251743 missense probably benign 0.00
R5110:Map3k6 UTSW 4 133247548 intron probably benign
R5258:Map3k6 UTSW 4 133247642 missense possibly damaging 0.81
R5369:Map3k6 UTSW 4 133247681 missense probably damaging 0.99
R5642:Map3k6 UTSW 4 133245544 missense probably damaging 0.99
R5648:Map3k6 UTSW 4 133243335 missense probably benign 0.25
R6102:Map3k6 UTSW 4 133247131 critical splice donor site probably null
R6144:Map3k6 UTSW 4 133245675 missense probably damaging 1.00
R6476:Map3k6 UTSW 4 133250086 missense probably damaging 0.98
R6511:Map3k6 UTSW 4 133248078 missense probably damaging 0.98
R6522:Map3k6 UTSW 4 133250024 missense possibly damaging 0.65
R6706:Map3k6 UTSW 4 133250939 nonsense probably null
R6874:Map3k6 UTSW 4 133250656 missense probably benign 0.02
R7069:Map3k6 UTSW 4 133251712 missense probably benign 0.01
R7216:Map3k6 UTSW 4 133246900 missense probably damaging 0.99
R7417:Map3k6 UTSW 4 133248396 missense probably benign 0.43
R7538:Map3k6 UTSW 4 133251927 missense probably benign
R7569:Map3k6 UTSW 4 133250077 missense probably benign 0.04
R8003:Map3k6 UTSW 4 133248882 missense probably benign 0.05
R8407:Map3k6 UTSW 4 133247593 missense possibly damaging 0.95
R8817:Map3k6 UTSW 4 133246760 missense probably benign 0.00
R8939:Map3k6 UTSW 4 133252643 unclassified probably benign
R9285:Map3k6 UTSW 4 133245559 missense probably damaging 1.00
R9308:Map3k6 UTSW 4 133243411 missense probably damaging 1.00
R9400:Map3k6 UTSW 4 133241156 missense probably damaging 1.00
R9401:Map3k6 UTSW 4 133241156 missense probably damaging 1.00
R9573:Map3k6 UTSW 4 133252463 missense probably damaging 0.99
R9677:Map3k6 UTSW 4 133241116 missense probably benign 0.04
R9682:Map3k6 UTSW 4 133248108 missense possibly damaging 0.61
R9745:Map3k6 UTSW 4 133252472 missense probably damaging 1.00
R9751:Map3k6 UTSW 4 133251857 critical splice acceptor site probably null
Z1088:Map3k6 UTSW 4 133245066 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGAGCCCTTAGTATGCACCTCTCC -3'
(R):5'- ATGTAATTCAGCCAGAAGGCAGCAC -3'

Sequencing Primer
(F):5'- agggatggggaaactcagg -3'
(R):5'- AGGCAGCACATGCTCTCTC -3'
Posted On 2014-04-24