Incidental Mutation 'R1607:Grk4'
Institutional Source Beutler Lab
Gene Symbol Grk4
Ensembl Gene ENSMUSG00000052783
Gene NameG protein-coupled receptor kinase 4
SynonymsGprk2l, A830025H08Rik
MMRRC Submission 039644-MU
Accession Numbers

Genbank: NM_019497.2, NM_001080743.1

Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R1607 (G1)
Quality Score225
Status Not validated
Chromosomal Location34660379-34755305 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34731538 bp
Amino Acid Change Valine to Alanine at position 342 (V342A)
Ref Sequence ENSEMBL: ENSMUSP00000001112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001112]
Predicted Effect probably benign
Transcript: ENSMUST00000001112
AA Change: V342A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000001112
Gene: ENSMUSG00000052783
AA Change: V342A

RGS 51 171 1.61e-31 SMART
S_TKc 186 448 7.78e-85 SMART
S_TK_X 449 528 2.98e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153323
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates the activated forms of G protein-coupled receptors thus initiating its deactivation. This gene has been linked to both genetic and acquired hypertension. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice heterozygous for a knock-out allele are viable, fertile and overtly normal. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(2)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C T 7: 120,251,291 P789S probably damaging Het
Adam17 T A 12: 21,334,138 probably null Het
Afdn C T 17: 13,810,501 R224W probably damaging Het
Als2 A G 1: 59,180,147 Y1215H probably damaging Het
Anks1b A T 10: 90,042,548 D73V probably damaging Het
Bpifb6 T C 2: 153,906,861 F259S probably damaging Het
Cenpv A T 11: 62,525,176 M249K probably benign Het
Ces1d C T 8: 93,186,118 V231I probably benign Het
Clasp1 G A 1: 118,504,959 V460I probably damaging Het
Cnot10 A T 9: 114,629,095 Y114* probably null Het
Cpb1 G T 3: 20,263,782 R193S probably benign Het
Ctc1 T C 11: 69,036,150 S1207P possibly damaging Het
Cttnbp2 T A 6: 18,435,433 K142M probably damaging Het
Dhrs7b T G 11: 60,851,891 D136E probably benign Het
Dnah7b T C 1: 46,290,646 S3217P probably damaging Het
Eif4g3 C T 4: 138,126,563 S480L probably benign Het
Enah A T 1: 181,917,197 probably null Het
Epx T C 11: 87,868,712 D517G probably damaging Het
Gabrg2 T A 11: 41,976,663 D43V probably damaging Het
Gdf9 A T 11: 53,437,511 E431D possibly damaging Het
Ghr T C 15: 3,320,574 D374G probably damaging Het
Gin1 A T 1: 97,786,150 I392F probably damaging Het
Greb1l A G 18: 10,529,703 E786G possibly damaging Het
Hhipl2 A T 1: 183,423,524 Y135F possibly damaging Het
Insig1 C T 5: 28,071,708 R91W probably damaging Het
Kcnf1 C G 12: 17,175,732 D163H probably benign Het
Kif11 A T 19: 37,387,200 K190* probably null Het
Ldb2 T G 5: 44,473,472 E309A probably damaging Het
Lipo4 T G 19: 33,512,673 D143A probably damaging Het
Map3k6 T G 4: 133,252,473 I1261S probably damaging Het
Mtus1 C T 8: 41,015,409 V27I possibly damaging Het
Ndufaf2 C T 13: 108,091,573 V60I probably benign Het
Nup133 A G 8: 123,949,035 F48L probably benign Het
Olfr1131 T A 2: 87,628,977 N171K probably benign Het
Olfr1357 G T 10: 78,612,140 T167N probably benign Het
Olfr1362 A C 13: 21,611,764 F68L probably benign Het
Pcdhb21 A T 18: 37,515,479 N554Y probably damaging Het
Pcx A T 19: 4,603,159 D284V possibly damaging Het
Pcyt1a T C 16: 32,467,119 S203P probably damaging Het
Pdlim3 A T 8: 45,896,859 I69F probably damaging Het
Pkp4 T C 2: 59,322,554 V598A probably benign Het
Plbd1 T C 6: 136,612,306 I509V probably benign Het
Polr3b C A 10: 84,652,783 T319N probably benign Het
Ptprj T C 2: 90,463,320 D380G probably benign Het
Ralgapa1 T G 12: 55,741,536 R587S probably damaging Het
Scn5a C A 9: 119,486,092 R1850L probably damaging Het
Ssc5d C A 7: 4,944,043 T1132K probably benign Het
Stard7 T A 2: 127,295,486 N285K possibly damaging Het
Tcp11l2 C T 10: 84,613,487 R439W probably damaging Het
Tecrl T C 5: 83,280,508 probably null Het
Tep1 A T 14: 50,824,563 L2570Q probably null Het
Tex14 A T 11: 87,554,928 D191V probably damaging Het
Tm7sf2 A G 19: 6,063,019 probably null Het
Tmem132e A G 11: 82,437,370 K408R probably benign Het
Tube1 A G 10: 39,144,766 D216G possibly damaging Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Vmn2r82 A G 10: 79,379,419 H412R possibly damaging Het
Wtip T C 7: 34,116,595 E352G probably damaging Het
Xirp2 T A 2: 67,510,295 L960* probably null Het
Zc3h11a A C 1: 133,624,687 S561A probably benign Het
Zfhx2 A T 14: 55,062,985 D2436E probably damaging Het
Zfp763 T C 17: 33,019,907 H88R probably benign Het
Other mutations in Grk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Grk4 APN 5 34716290 missense probably damaging 0.99
IGL00574:Grk4 APN 5 34694818 missense probably benign 0.00
IGL02127:Grk4 APN 5 34710186 missense probably benign 0.00
IGL02191:Grk4 APN 5 34755189 missense probably benign 0.27
IGL02227:Grk4 APN 5 34694782 missense probably benign 0.06
IGL03152:Grk4 APN 5 34745357 missense probably damaging 1.00
IGL03214:Grk4 APN 5 34752209 missense probably benign
F5426:Grk4 UTSW 5 34745159 splice site probably benign
R0110:Grk4 UTSW 5 34716213 missense probably damaging 0.97
R0469:Grk4 UTSW 5 34716213 missense probably damaging 0.97
R0671:Grk4 UTSW 5 34748267 missense probably benign 0.04
R1466:Grk4 UTSW 5 34694750 missense probably benign 0.02
R1466:Grk4 UTSW 5 34694750 missense probably benign 0.02
R1584:Grk4 UTSW 5 34694750 missense probably benign 0.02
R1605:Grk4 UTSW 5 34674557 missense probably damaging 0.98
R1903:Grk4 UTSW 5 34676187 splice site probably null
R2352:Grk4 UTSW 5 34669176 missense probably benign 0.04
R4561:Grk4 UTSW 5 34694813 missense probably benign 0.00
R4580:Grk4 UTSW 5 34660981 missense probably damaging 1.00
R4807:Grk4 UTSW 5 34752208 missense probably benign
R5412:Grk4 UTSW 5 34745268 missense probably benign 0.00
R5905:Grk4 UTSW 5 34711730 missense probably damaging 1.00
R6360:Grk4 UTSW 5 34674537 missense probably damaging 1.00
R6604:Grk4 UTSW 5 34719864 missense probably damaging 1.00
R6865:Grk4 UTSW 5 34731550 missense probably damaging 1.00
R7265:Grk4 UTSW 5 34716264 missense probably damaging 0.96
R7394:Grk4 UTSW 5 34751618 missense probably benign
X0064:Grk4 UTSW 5 34719884 missense possibly damaging 0.76
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tgtgaaagcagagaactgacc -3'
Posted On2014-04-24