Incidental Mutation 'R1607:Vmn2r82'
ID176561
Institutional Source Beutler Lab
Gene Symbol Vmn2r82
Ensembl Gene ENSMUSG00000091468
Gene Namevomeronasal 2, receptor 82
SynonymsEG624845
MMRRC Submission 039644-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1607 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location79356576-79397198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79379419 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 412 (H412R)
Ref Sequence ENSEMBL: ENSMUSP00000130114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170596]
Predicted Effect possibly damaging
Transcript: ENSMUST00000170596
AA Change: H412R

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130114
Gene: ENSMUSG00000091468
AA Change: H412R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 79 474 6e-35 PFAM
Pfam:NCD3G 517 570 9.3e-22 PFAM
Pfam:7tm_3 603 838 6.5e-49 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C T 7: 120,251,291 P789S probably damaging Het
Adam17 T A 12: 21,334,138 probably null Het
Afdn C T 17: 13,810,501 R224W probably damaging Het
Als2 A G 1: 59,180,147 Y1215H probably damaging Het
Anks1b A T 10: 90,042,548 D73V probably damaging Het
Bpifb6 T C 2: 153,906,861 F259S probably damaging Het
Cenpv A T 11: 62,525,176 M249K probably benign Het
Ces1d C T 8: 93,186,118 V231I probably benign Het
Clasp1 G A 1: 118,504,959 V460I probably damaging Het
Cnot10 A T 9: 114,629,095 Y114* probably null Het
Cpb1 G T 3: 20,263,782 R193S probably benign Het
Ctc1 T C 11: 69,036,150 S1207P possibly damaging Het
Cttnbp2 T A 6: 18,435,433 K142M probably damaging Het
Dhrs7b T G 11: 60,851,891 D136E probably benign Het
Dnah7b T C 1: 46,290,646 S3217P probably damaging Het
Eif4g3 C T 4: 138,126,563 S480L probably benign Het
Enah A T 1: 181,917,197 probably null Het
Epx T C 11: 87,868,712 D517G probably damaging Het
Gabrg2 T A 11: 41,976,663 D43V probably damaging Het
Gdf9 A T 11: 53,437,511 E431D possibly damaging Het
Ghr T C 15: 3,320,574 D374G probably damaging Het
Gin1 A T 1: 97,786,150 I392F probably damaging Het
Greb1l A G 18: 10,529,703 E786G possibly damaging Het
Grk4 T C 5: 34,731,538 V342A probably benign Het
Hhipl2 A T 1: 183,423,524 Y135F possibly damaging Het
Insig1 C T 5: 28,071,708 R91W probably damaging Het
Kcnf1 C G 12: 17,175,732 D163H probably benign Het
Kif11 A T 19: 37,387,200 K190* probably null Het
Ldb2 T G 5: 44,473,472 E309A probably damaging Het
Lipo4 T G 19: 33,512,673 D143A probably damaging Het
Map3k6 T G 4: 133,252,473 I1261S probably damaging Het
Mtus1 C T 8: 41,015,409 V27I possibly damaging Het
Ndufaf2 C T 13: 108,091,573 V60I probably benign Het
Nup133 A G 8: 123,949,035 F48L probably benign Het
Olfr1131 T A 2: 87,628,977 N171K probably benign Het
Olfr1357 G T 10: 78,612,140 T167N probably benign Het
Olfr1362 A C 13: 21,611,764 F68L probably benign Het
Pcdhb21 A T 18: 37,515,479 N554Y probably damaging Het
Pcx A T 19: 4,603,159 D284V possibly damaging Het
Pcyt1a T C 16: 32,467,119 S203P probably damaging Het
Pdlim3 A T 8: 45,896,859 I69F probably damaging Het
Pkp4 T C 2: 59,322,554 V598A probably benign Het
Plbd1 T C 6: 136,612,306 I509V probably benign Het
Polr3b C A 10: 84,652,783 T319N probably benign Het
Ptprj T C 2: 90,463,320 D380G probably benign Het
Ralgapa1 T G 12: 55,741,536 R587S probably damaging Het
Scn5a C A 9: 119,486,092 R1850L probably damaging Het
Ssc5d C A 7: 4,944,043 T1132K probably benign Het
Stard7 T A 2: 127,295,486 N285K possibly damaging Het
Tcp11l2 C T 10: 84,613,487 R439W probably damaging Het
Tecrl T C 5: 83,280,508 probably null Het
Tep1 A T 14: 50,824,563 L2570Q probably null Het
Tex14 A T 11: 87,554,928 D191V probably damaging Het
Tm7sf2 A G 19: 6,063,019 probably null Het
Tmem132e A G 11: 82,437,370 K408R probably benign Het
Tube1 A G 10: 39,144,766 D216G possibly damaging Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Wtip T C 7: 34,116,595 E352G probably damaging Het
Xirp2 T A 2: 67,510,295 L960* probably null Het
Zc3h11a A C 1: 133,624,687 S561A probably benign Het
Zfhx2 A T 14: 55,062,985 D2436E probably damaging Het
Zfp763 T C 17: 33,019,907 H88R probably benign Het
Other mutations in Vmn2r82
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01800:Vmn2r82 APN 10 79356747 missense probably benign 0.03
IGL01860:Vmn2r82 APN 10 79378857 missense probably benign 0.18
IGL01927:Vmn2r82 APN 10 79378072 missense probably damaging 1.00
IGL01929:Vmn2r82 APN 10 79378711 missense probably damaging 1.00
IGL02028:Vmn2r82 APN 10 79379223 missense probably benign
IGL02112:Vmn2r82 APN 10 79395999 missense probably benign 0.19
IGL02632:Vmn2r82 APN 10 79356708 missense probably benign 0.45
IGL02665:Vmn2r82 APN 10 79379371 missense probably damaging 0.99
IGL02716:Vmn2r82 APN 10 79377844 missense probably benign 0.20
IGL03030:Vmn2r82 APN 10 79381315 missense possibly damaging 0.85
IGL03190:Vmn2r82 APN 10 79356809 splice site probably null
IGL03349:Vmn2r82 APN 10 79377869 missense probably benign 0.25
IGL03048:Vmn2r82 UTSW 10 79396626 missense probably damaging 0.98
R0080:Vmn2r82 UTSW 10 79396505 missense probably benign 0.00
R0193:Vmn2r82 UTSW 10 79381295 missense probably damaging 1.00
R0217:Vmn2r82 UTSW 10 79378800 missense possibly damaging 0.46
R0285:Vmn2r82 UTSW 10 79396557 missense probably damaging 1.00
R1193:Vmn2r82 UTSW 10 79377905 nonsense probably null
R1385:Vmn2r82 UTSW 10 79396491 nonsense probably null
R1386:Vmn2r82 UTSW 10 79378711 missense probably damaging 1.00
R1442:Vmn2r82 UTSW 10 79379367 missense probably benign 0.03
R1467:Vmn2r82 UTSW 10 79396299 missense probably benign 0.00
R1467:Vmn2r82 UTSW 10 79396299 missense probably benign 0.00
R1518:Vmn2r82 UTSW 10 79378868 missense probably damaging 1.00
R1538:Vmn2r82 UTSW 10 79356744 missense possibly damaging 0.92
R1812:Vmn2r82 UTSW 10 79379212 missense probably benign 0.33
R1906:Vmn2r82 UTSW 10 79396510 missense probably damaging 1.00
R1954:Vmn2r82 UTSW 10 79396056 missense probably damaging 1.00
R1972:Vmn2r82 UTSW 10 79378846 missense probably damaging 1.00
R2093:Vmn2r82 UTSW 10 79395979 missense probably benign 0.30
R2156:Vmn2r82 UTSW 10 79378888 missense probably damaging 1.00
R2202:Vmn2r82 UTSW 10 79356685 missense probably benign
R2442:Vmn2r82 UTSW 10 79385376 missense probably damaging 1.00
R2444:Vmn2r82 UTSW 10 79377868 missense possibly damaging 0.65
R2857:Vmn2r82 UTSW 10 79381256 missense probably damaging 0.98
R2858:Vmn2r82 UTSW 10 79381256 missense probably damaging 0.98
R2884:Vmn2r82 UTSW 10 79396248 missense probably benign 0.00
R2886:Vmn2r82 UTSW 10 79396248 missense probably benign 0.00
R4369:Vmn2r82 UTSW 10 79396080 missense probably benign 0.01
R4445:Vmn2r82 UTSW 10 79379040 missense possibly damaging 0.87
R4589:Vmn2r82 UTSW 10 79356714 missense probably damaging 1.00
R4703:Vmn2r82 UTSW 10 79378807 missense probably damaging 1.00
R4908:Vmn2r82 UTSW 10 79378755 missense probably benign 0.00
R4937:Vmn2r82 UTSW 10 79379176 missense probably benign 0.01
R5199:Vmn2r82 UTSW 10 79396087 missense probably damaging 1.00
R5391:Vmn2r82 UTSW 10 79356657 missense probably null 0.01
R5601:Vmn2r82 UTSW 10 79396191 missense probably damaging 1.00
R5635:Vmn2r82 UTSW 10 79378818 missense probably benign 0.33
R6065:Vmn2r82 UTSW 10 79385376 missense probably damaging 1.00
R6074:Vmn2r82 UTSW 10 79396543 missense probably damaging 1.00
R6340:Vmn2r82 UTSW 10 79395893 missense probably benign 0.00
R6474:Vmn2r82 UTSW 10 79379037 missense possibly damaging 0.55
R6995:Vmn2r82 UTSW 10 79396543 missense probably damaging 1.00
R7111:Vmn2r82 UTSW 10 79378771 missense probably benign 0.22
R7212:Vmn2r82 UTSW 10 79379434 missense probably benign 0.00
R7335:Vmn2r82 UTSW 10 79378888 missense probably damaging 1.00
R7353:Vmn2r82 UTSW 10 79396618 missense probably benign 0.11
R7354:Vmn2r82 UTSW 10 79356630 missense probably benign 0.00
R7362:Vmn2r82 UTSW 10 79396617 missense probably benign 0.00
R7378:Vmn2r82 UTSW 10 79396442 nonsense probably null
R7430:Vmn2r82 UTSW 10 79381253 missense probably damaging 1.00
R7509:Vmn2r82 UTSW 10 79396008 missense possibly damaging 0.82
R7874:Vmn2r82 UTSW 10 79396511 missense probably damaging 1.00
R7943:Vmn2r82 UTSW 10 79396245 missense possibly damaging 0.74
R8158:Vmn2r82 UTSW 10 79377802 missense probably benign 0.12
R8324:Vmn2r82 UTSW 10 79378893 nonsense probably null
R8340:Vmn2r82 UTSW 10 79381202 missense probably benign 0.00
Z1088:Vmn2r82 UTSW 10 79356622 missense probably damaging 1.00
Z1177:Vmn2r82 UTSW 10 79356595 missense probably benign 0.03
Z1177:Vmn2r82 UTSW 10 79396535 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAATCATCGACCGCAGACGTG -3'
(R):5'- CTGTTAAATGCAATCTTCCACAGGTGC -3'

Sequencing Primer
(F):5'- ACCCCATTATGAGGAGATTGCTG -3'
(R):5'- TGTACATTGATATCTAGGCACCG -3'
Posted On2014-04-24