Incidental Mutation 'R1607:Pcyt1a'
ID176584
Institutional Source Beutler Lab
Gene Symbol Pcyt1a
Ensembl Gene ENSMUSG00000005615
Gene Namephosphate cytidylyltransferase 1, choline, alpha isoform
SynonymsCTP:phosphocholine cytidylyltransferase alpha, Cttalpha, Ctpct, Cctalpha, CTalpha
MMRRC Submission 039644-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1607 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location32430921-32475070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32467119 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 203 (S203P)
Ref Sequence ENSEMBL: ENSMUSP00000110793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079791] [ENSMUST00000104893] [ENSMUST00000115137] [ENSMUST00000115140]
Predicted Effect probably damaging
Transcript: ENSMUST00000079791
AA Change: S203P

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000078721
Gene: ENSMUSG00000005615
AA Change: S203P

DomainStartEndE-ValueType
Pfam:CTP_transf_2 80 208 6.4e-24 PFAM
low complexity region 244 262 N/A INTRINSIC
low complexity region 328 352 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000104893
AA Change: S203P

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130056
Gene: ENSMUSG00000005615
AA Change: S203P

DomainStartEndE-ValueType
Pfam:CTP_transf_2 80 208 6.4e-24 PFAM
low complexity region 244 262 N/A INTRINSIC
low complexity region 328 352 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115137
SMART Domains Protein: ENSMUSP00000110790
Gene: ENSMUSG00000005615

DomainStartEndE-ValueType
Pfam:CTP_transf_2 80 201 4.1e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115140
AA Change: S203P

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110793
Gene: ENSMUSG00000005615
AA Change: S203P

DomainStartEndE-ValueType
Pfam:CTP_transf_like 80 208 3.2e-33 PFAM
low complexity region 244 262 N/A INTRINSIC
low complexity region 328 352 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231920
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the cytidylyltransferase family and is involved in the regulation of phosphatidylcholine biosynthesis. Mutations in this gene are associated with spondylometaphyseal dysplasia with cone-rod dystrophy. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Embryos homozygous for a targeted null mutation fail to form blastocysts, do not develop past E3.5, and fail to implant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C T 7: 120,251,291 P789S probably damaging Het
Adam17 T A 12: 21,334,138 probably null Het
Afdn C T 17: 13,810,501 R224W probably damaging Het
Als2 A G 1: 59,180,147 Y1215H probably damaging Het
Anks1b A T 10: 90,042,548 D73V probably damaging Het
Bpifb6 T C 2: 153,906,861 F259S probably damaging Het
Cenpv A T 11: 62,525,176 M249K probably benign Het
Ces1d C T 8: 93,186,118 V231I probably benign Het
Clasp1 G A 1: 118,504,959 V460I probably damaging Het
Cnot10 A T 9: 114,629,095 Y114* probably null Het
Cpb1 G T 3: 20,263,782 R193S probably benign Het
Ctc1 T C 11: 69,036,150 S1207P possibly damaging Het
Cttnbp2 T A 6: 18,435,433 K142M probably damaging Het
Dhrs7b T G 11: 60,851,891 D136E probably benign Het
Dnah7b T C 1: 46,290,646 S3217P probably damaging Het
Eif4g3 C T 4: 138,126,563 S480L probably benign Het
Enah A T 1: 181,917,197 probably null Het
Epx T C 11: 87,868,712 D517G probably damaging Het
Gabrg2 T A 11: 41,976,663 D43V probably damaging Het
Gdf9 A T 11: 53,437,511 E431D possibly damaging Het
Ghr T C 15: 3,320,574 D374G probably damaging Het
Gin1 A T 1: 97,786,150 I392F probably damaging Het
Greb1l A G 18: 10,529,703 E786G possibly damaging Het
Grk4 T C 5: 34,731,538 V342A probably benign Het
Hhipl2 A T 1: 183,423,524 Y135F possibly damaging Het
Insig1 C T 5: 28,071,708 R91W probably damaging Het
Kcnf1 C G 12: 17,175,732 D163H probably benign Het
Kif11 A T 19: 37,387,200 K190* probably null Het
Ldb2 T G 5: 44,473,472 E309A probably damaging Het
Lipo4 T G 19: 33,512,673 D143A probably damaging Het
Map3k6 T G 4: 133,252,473 I1261S probably damaging Het
Mtus1 C T 8: 41,015,409 V27I possibly damaging Het
Ndufaf2 C T 13: 108,091,573 V60I probably benign Het
Nup133 A G 8: 123,949,035 F48L probably benign Het
Olfr1131 T A 2: 87,628,977 N171K probably benign Het
Olfr1357 G T 10: 78,612,140 T167N probably benign Het
Olfr1362 A C 13: 21,611,764 F68L probably benign Het
Pcdhb21 A T 18: 37,515,479 N554Y probably damaging Het
Pcx A T 19: 4,603,159 D284V possibly damaging Het
Pdlim3 A T 8: 45,896,859 I69F probably damaging Het
Pkp4 T C 2: 59,322,554 V598A probably benign Het
Plbd1 T C 6: 136,612,306 I509V probably benign Het
Polr3b C A 10: 84,652,783 T319N probably benign Het
Ptprj T C 2: 90,463,320 D380G probably benign Het
Ralgapa1 T G 12: 55,741,536 R587S probably damaging Het
Scn5a C A 9: 119,486,092 R1850L probably damaging Het
Ssc5d C A 7: 4,944,043 T1132K probably benign Het
Stard7 T A 2: 127,295,486 N285K possibly damaging Het
Tcp11l2 C T 10: 84,613,487 R439W probably damaging Het
Tecrl T C 5: 83,280,508 probably null Het
Tep1 A T 14: 50,824,563 L2570Q probably null Het
Tex14 A T 11: 87,554,928 D191V probably damaging Het
Tm7sf2 A G 19: 6,063,019 probably null Het
Tmem132e A G 11: 82,437,370 K408R probably benign Het
Tube1 A G 10: 39,144,766 D216G possibly damaging Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Vmn2r82 A G 10: 79,379,419 H412R possibly damaging Het
Wtip T C 7: 34,116,595 E352G probably damaging Het
Xirp2 T A 2: 67,510,295 L960* probably null Het
Zc3h11a A C 1: 133,624,687 S561A probably benign Het
Zfhx2 A T 14: 55,062,985 D2436E probably damaging Het
Zfp763 T C 17: 33,019,907 H88R probably benign Het
Other mutations in Pcyt1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Pcyt1a APN 16 32467101 missense probably damaging 0.99
IGL02147:Pcyt1a APN 16 32462098 missense probably damaging 1.00
R0164:Pcyt1a UTSW 16 32470186 missense probably damaging 1.00
R0164:Pcyt1a UTSW 16 32470186 missense probably damaging 1.00
R1529:Pcyt1a UTSW 16 32451793 missense possibly damaging 0.45
R4693:Pcyt1a UTSW 16 32470224 unclassified probably benign
R4998:Pcyt1a UTSW 16 32451842 splice site probably benign
R6488:Pcyt1a UTSW 16 32467081 missense probably damaging 0.98
R6852:Pcyt1a UTSW 16 32470120 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTGGGCGACTATGGAGATTCAGC -3'
(R):5'- GGGGAATGACAATCTCACAGCACAC -3'

Sequencing Primer
(F):5'- tcctttccttttcctttccttttc -3'
(R):5'- TCACAGCACACTGAAAAGTGAG -3'
Posted On2014-04-24