Incidental Mutation 'R1607:Greb1l'
ID 176589
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Name growth regulation by estrogen in breast cancer-like
Synonyms mKIAA4095, AK220484
MMRRC Submission 039644-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1607 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 10325177-10562940 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 10529703 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 786 (E786G)
Ref Sequence ENSEMBL: ENSMUSP00000134090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172680]
AlphaFold B9EJV3
Predicted Effect possibly damaging
Transcript: ENSMUST00000048977
AA Change: E895G

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: E895G

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172532
AA Change: E786G

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: E786G

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172680
SMART Domains Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.5%
Validation Efficiency
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C T 7: 119,850,514 (GRCm39) P789S probably damaging Het
Adam17 T A 12: 21,384,139 (GRCm39) probably null Het
Afdn C T 17: 14,030,763 (GRCm39) R224W probably damaging Het
Als2 A G 1: 59,219,306 (GRCm39) Y1215H probably damaging Het
Anks1b A T 10: 89,878,410 (GRCm39) D73V probably damaging Het
Bpifb6 T C 2: 153,748,781 (GRCm39) F259S probably damaging Het
Cenpv A T 11: 62,416,002 (GRCm39) M249K probably benign Het
Ces1d C T 8: 93,912,746 (GRCm39) V231I probably benign Het
Clasp1 G A 1: 118,432,689 (GRCm39) V460I probably damaging Het
Cnot10 A T 9: 114,458,163 (GRCm39) Y114* probably null Het
Cpb1 G T 3: 20,317,946 (GRCm39) R193S probably benign Het
Ctc1 T C 11: 68,926,976 (GRCm39) S1207P possibly damaging Het
Cttnbp2 T A 6: 18,435,432 (GRCm39) K142M probably damaging Het
Dhrs7b T G 11: 60,742,717 (GRCm39) D136E probably benign Het
Dnah7b T C 1: 46,329,806 (GRCm39) S3217P probably damaging Het
Eif4g3 C T 4: 137,853,874 (GRCm39) S480L probably benign Het
Enah A T 1: 181,744,762 (GRCm39) probably null Het
Epx T C 11: 87,759,538 (GRCm39) D517G probably damaging Het
Gabrg2 T A 11: 41,867,490 (GRCm39) D43V probably damaging Het
Gdf9 A T 11: 53,328,338 (GRCm39) E431D possibly damaging Het
Ghr T C 15: 3,350,056 (GRCm39) D374G probably damaging Het
Gin1 A T 1: 97,713,875 (GRCm39) I392F probably damaging Het
Grk4 T C 5: 34,888,882 (GRCm39) V342A probably benign Het
Hhipl2 A T 1: 183,204,432 (GRCm39) Y135F possibly damaging Het
Insig1 C T 5: 28,276,706 (GRCm39) R91W probably damaging Het
Kcnf1 C G 12: 17,225,733 (GRCm39) D163H probably benign Het
Kif11 A T 19: 37,375,648 (GRCm39) K190* probably null Het
Ldb2 T G 5: 44,630,814 (GRCm39) E309A probably damaging Het
Lipo4 T G 19: 33,490,073 (GRCm39) D143A probably damaging Het
Map3k6 T G 4: 132,979,784 (GRCm39) I1261S probably damaging Het
Mtus1 C T 8: 41,468,446 (GRCm39) V27I possibly damaging Het
Ndufaf2 C T 13: 108,228,107 (GRCm39) V60I probably benign Het
Nup133 A G 8: 124,675,774 (GRCm39) F48L probably benign Het
Or1i2 G T 10: 78,447,974 (GRCm39) T167N probably benign Het
Or2w4 A C 13: 21,795,934 (GRCm39) F68L probably benign Het
Or5w11 T A 2: 87,459,321 (GRCm39) N171K probably benign Het
Pcdhb21 A T 18: 37,648,532 (GRCm39) N554Y probably damaging Het
Pcx A T 19: 4,653,187 (GRCm39) D284V possibly damaging Het
Pcyt1a T C 16: 32,285,937 (GRCm39) S203P probably damaging Het
Pdlim3 A T 8: 46,349,896 (GRCm39) I69F probably damaging Het
Pkp4 T C 2: 59,152,898 (GRCm39) V598A probably benign Het
Plbd1 T C 6: 136,589,304 (GRCm39) I509V probably benign Het
Polr3b C A 10: 84,488,647 (GRCm39) T319N probably benign Het
Ptprj T C 2: 90,293,664 (GRCm39) D380G probably benign Het
Ralgapa1 T G 12: 55,788,321 (GRCm39) R587S probably damaging Het
Scn5a C A 9: 119,315,158 (GRCm39) R1850L probably damaging Het
Ssc5d C A 7: 4,947,042 (GRCm39) T1132K probably benign Het
Stard7 T A 2: 127,137,406 (GRCm39) N285K possibly damaging Het
Tcp11l2 C T 10: 84,449,351 (GRCm39) R439W probably damaging Het
Tecrl T C 5: 83,428,355 (GRCm39) probably null Het
Tep1 A T 14: 51,062,020 (GRCm39) L2570Q probably null Het
Tex14 A T 11: 87,445,754 (GRCm39) D191V probably damaging Het
Tm7sf2 A G 19: 6,113,049 (GRCm39) probably null Het
Tmem132e A G 11: 82,328,196 (GRCm39) K408R probably benign Het
Tube1 A G 10: 39,020,762 (GRCm39) D216G possibly damaging Het
Ubap2 C T 4: 41,199,872 (GRCm39) A752T probably benign Het
Vmn2r82 A G 10: 79,215,253 (GRCm39) H412R possibly damaging Het
Wtip T C 7: 33,816,020 (GRCm39) E352G probably damaging Het
Xirp2 T A 2: 67,340,639 (GRCm39) L960* probably null Het
Zc3h11a A C 1: 133,552,425 (GRCm39) S561A probably benign Het
Zfhx2 A T 14: 55,300,442 (GRCm39) D2436E probably damaging Het
Zfp763 T C 17: 33,238,881 (GRCm39) H88R probably benign Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10,555,962 (GRCm39) missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10,522,144 (GRCm39) missense probably benign 0.01
IGL01563:Greb1l APN 18 10,469,399 (GRCm39) missense probably damaging 0.99
IGL01944:Greb1l APN 18 10,557,280 (GRCm39) missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10,515,271 (GRCm39) missense probably damaging 1.00
IGL02249:Greb1l APN 18 10,532,961 (GRCm39) missense probably damaging 1.00
IGL02318:Greb1l APN 18 10,469,388 (GRCm39) missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10,515,200 (GRCm39) missense probably damaging 0.99
IGL02516:Greb1l APN 18 10,537,064 (GRCm39) missense probably benign 0.31
IGL02566:Greb1l APN 18 10,503,299 (GRCm39) missense probably damaging 0.99
IGL02583:Greb1l APN 18 10,542,362 (GRCm39) missense probably damaging 1.00
IGL02838:Greb1l APN 18 10,560,430 (GRCm39) missense probably damaging 1.00
A4554:Greb1l UTSW 18 10,532,862 (GRCm39) missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10,533,032 (GRCm39) missense probably benign 0.08
PIT4453001:Greb1l UTSW 18 10,533,031 (GRCm39) missense probably damaging 0.98
R0099:Greb1l UTSW 18 10,509,158 (GRCm39) missense probably damaging 1.00
R0226:Greb1l UTSW 18 10,522,076 (GRCm39) intron probably benign
R0234:Greb1l UTSW 18 10,560,331 (GRCm39) missense probably damaging 1.00
R0234:Greb1l UTSW 18 10,560,331 (GRCm39) missense probably damaging 1.00
R0239:Greb1l UTSW 18 10,458,567 (GRCm39) splice site probably benign
R0316:Greb1l UTSW 18 10,547,420 (GRCm39) missense probably damaging 1.00
R0369:Greb1l UTSW 18 10,469,375 (GRCm39) missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10,523,374 (GRCm39) missense probably damaging 0.99
R0478:Greb1l UTSW 18 10,509,281 (GRCm39) missense probably damaging 1.00
R0555:Greb1l UTSW 18 10,458,781 (GRCm39) splice site probably benign
R0671:Greb1l UTSW 18 10,474,303 (GRCm39) missense probably damaging 1.00
R1282:Greb1l UTSW 18 10,547,289 (GRCm39) missense probably benign 0.13
R1574:Greb1l UTSW 18 10,554,997 (GRCm39) missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10,554,997 (GRCm39) missense possibly damaging 0.95
R1666:Greb1l UTSW 18 10,529,708 (GRCm39) critical splice donor site probably null
R1666:Greb1l UTSW 18 10,501,080 (GRCm39) critical splice donor site probably null
R1720:Greb1l UTSW 18 10,553,848 (GRCm39) missense probably benign 0.19
R1808:Greb1l UTSW 18 10,542,143 (GRCm39) missense probably benign
R1829:Greb1l UTSW 18 10,509,314 (GRCm39) missense probably damaging 1.00
R1897:Greb1l UTSW 18 10,498,992 (GRCm39) missense probably benign 0.00
R1967:Greb1l UTSW 18 10,501,049 (GRCm39) missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10,515,221 (GRCm39) missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10,523,281 (GRCm39) missense probably damaging 1.00
R2125:Greb1l UTSW 18 10,511,422 (GRCm39) missense probably damaging 0.98
R2139:Greb1l UTSW 18 10,555,011 (GRCm39) missense probably damaging 1.00
R2255:Greb1l UTSW 18 10,554,857 (GRCm39) missense probably damaging 1.00
R2256:Greb1l UTSW 18 10,503,307 (GRCm39) missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10,503,307 (GRCm39) missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10,547,288 (GRCm39) missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10,542,380 (GRCm39) missense probably damaging 0.99
R3778:Greb1l UTSW 18 10,469,444 (GRCm39) missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10,522,247 (GRCm39) missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10,515,209 (GRCm39) missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10,522,150 (GRCm39) missense probably damaging 0.99
R4134:Greb1l UTSW 18 10,529,708 (GRCm39) critical splice donor site probably null
R4342:Greb1l UTSW 18 10,544,561 (GRCm39) missense probably benign 0.12
R4409:Greb1l UTSW 18 10,503,182 (GRCm39) missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10,553,705 (GRCm39) missense probably damaging 1.00
R4618:Greb1l UTSW 18 10,498,965 (GRCm39) missense probably benign 0.00
R4683:Greb1l UTSW 18 10,529,563 (GRCm39) splice site probably null
R4686:Greb1l UTSW 18 10,522,112 (GRCm39) missense probably damaging 0.98
R4707:Greb1l UTSW 18 10,532,922 (GRCm39) missense probably benign 0.02
R4780:Greb1l UTSW 18 10,541,792 (GRCm39) missense probably benign 0.00
R4819:Greb1l UTSW 18 10,458,358 (GRCm39) missense probably damaging 1.00
R4925:Greb1l UTSW 18 10,547,447 (GRCm39) missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10,547,306 (GRCm39) missense probably damaging 0.99
R5150:Greb1l UTSW 18 10,555,950 (GRCm39) frame shift probably null
R5154:Greb1l UTSW 18 10,458,312 (GRCm39) missense probably benign 0.02
R5269:Greb1l UTSW 18 10,511,409 (GRCm39) missense probably benign
R5290:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5310:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5328:Greb1l UTSW 18 10,553,720 (GRCm39) missense probably damaging 1.00
R5337:Greb1l UTSW 18 10,509,143 (GRCm39) missense probably damaging 1.00
R5393:Greb1l UTSW 18 10,458,312 (GRCm39) missense probably benign 0.02
R5402:Greb1l UTSW 18 10,537,169 (GRCm39) missense probably benign 0.26
R5718:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5719:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5720:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5721:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5902:Greb1l UTSW 18 10,538,302 (GRCm39) missense probably benign 0.00
R5993:Greb1l UTSW 18 10,544,455 (GRCm39) missense probably benign 0.10
R6035:Greb1l UTSW 18 10,501,025 (GRCm39) missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10,501,025 (GRCm39) missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10,547,068 (GRCm39) missense probably damaging 1.00
R6063:Greb1l UTSW 18 10,557,340 (GRCm39) missense probably damaging 1.00
R6297:Greb1l UTSW 18 10,469,494 (GRCm39) missense probably damaging 1.00
R6405:Greb1l UTSW 18 10,501,076 (GRCm39) missense probably benign 0.30
R6552:Greb1l UTSW 18 10,541,814 (GRCm39) missense probably benign 0.00
R6572:Greb1l UTSW 18 10,522,131 (GRCm39) missense probably benign 0.07
R6575:Greb1l UTSW 18 10,547,347 (GRCm39) missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10,547,482 (GRCm39) missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10,558,786 (GRCm39) missense probably benign 0.23
R6962:Greb1l UTSW 18 10,547,327 (GRCm39) missense probably damaging 1.00
R7012:Greb1l UTSW 18 10,529,707 (GRCm39) critical splice donor site probably null
R7179:Greb1l UTSW 18 10,544,576 (GRCm39) missense probably benign 0.00
R7251:Greb1l UTSW 18 10,515,319 (GRCm39) missense probably damaging 1.00
R7275:Greb1l UTSW 18 10,544,561 (GRCm39) missense probably benign 0.12
R7301:Greb1l UTSW 18 10,544,970 (GRCm39) missense probably damaging 1.00
R7307:Greb1l UTSW 18 10,538,142 (GRCm39) missense probably damaging 0.99
R7455:Greb1l UTSW 18 10,554,915 (GRCm39) missense probably damaging 1.00
R7832:Greb1l UTSW 18 10,542,056 (GRCm39) missense probably benign 0.38
R7934:Greb1l UTSW 18 10,474,371 (GRCm39) nonsense probably null
R8137:Greb1l UTSW 18 10,474,357 (GRCm39) missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10,533,060 (GRCm39) missense probably benign 0.13
R8208:Greb1l UTSW 18 10,510,703 (GRCm39) missense probably damaging 1.00
R8227:Greb1l UTSW 18 10,515,371 (GRCm39) missense probably damaging 1.00
R8312:Greb1l UTSW 18 10,511,587 (GRCm39) intron probably benign
R8331:Greb1l UTSW 18 10,458,706 (GRCm39) missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10,529,687 (GRCm39) missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10,529,613 (GRCm39) missense probably benign 0.00
R8695:Greb1l UTSW 18 10,544,450 (GRCm39) missense probably benign 0.01
R8795:Greb1l UTSW 18 10,553,739 (GRCm39) missense probably damaging 0.98
R8836:Greb1l UTSW 18 10,509,257 (GRCm39) missense probably benign 0.30
R8862:Greb1l UTSW 18 10,555,042 (GRCm39) missense possibly damaging 0.90
R8872:Greb1l UTSW 18 10,529,684 (GRCm39) missense probably benign 0.18
R8874:Greb1l UTSW 18 10,544,896 (GRCm39) missense probably benign 0.01
R8886:Greb1l UTSW 18 10,553,843 (GRCm39) missense probably benign 0.21
R8921:Greb1l UTSW 18 10,541,825 (GRCm39) missense probably benign 0.01
R8997:Greb1l UTSW 18 10,510,747 (GRCm39) missense probably damaging 1.00
R9015:Greb1l UTSW 18 10,541,675 (GRCm39) missense probably benign 0.00
R9018:Greb1l UTSW 18 10,542,004 (GRCm39) missense possibly damaging 0.76
R9074:Greb1l UTSW 18 10,558,795 (GRCm39) missense probably damaging 1.00
R9074:Greb1l UTSW 18 10,532,797 (GRCm39) missense probably damaging 1.00
R9117:Greb1l UTSW 18 10,542,422 (GRCm39) missense probably benign 0.31
R9189:Greb1l UTSW 18 10,499,983 (GRCm39) missense probably benign
R9332:Greb1l UTSW 18 10,532,796 (GRCm39) missense possibly damaging 0.92
R9367:Greb1l UTSW 18 10,522,130 (GRCm39) missense probably benign 0.00
R9497:Greb1l UTSW 18 10,458,600 (GRCm39) missense probably benign 0.00
R9796:Greb1l UTSW 18 10,538,233 (GRCm39) missense possibly damaging 0.69
Z1176:Greb1l UTSW 18 10,515,305 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTGGTGTCAAGTTCACAGCCGC -3'
(R):5'- TCTTCTTGGAGGGCTACCCGAAAC -3'

Sequencing Primer
(F):5'- AAGTTCACAGCCGCTTCCC -3'
(R):5'- TACCCGAAACCCGTGGTAG -3'
Posted On 2014-04-24