Incidental Mutation 'R1607:Greb1l'
ID 176589
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Name growth regulation by estrogen in breast cancer-like
Synonyms AK220484, mKIAA4095
MMRRC Submission 039644-MU
Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Essential gene? Essential (E-score: 1.000) question?
Stock # R1607 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 10325177-10562934 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 10529703 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 786 (E786G)
Ref Sequence ENSEMBL: ENSMUSP00000134090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172680]
AlphaFold B9EJV3
Predicted Effect possibly damaging
Transcript: ENSMUST00000048977
AA Change: E895G

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: E895G

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172532
AA Change: E786G

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: E786G

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172680
SMART Domains Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.5%
Validation Efficiency
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C T 7: 120,251,291 P789S probably damaging Het
Adam17 T A 12: 21,334,138 probably null Het
Afdn C T 17: 13,810,501 R224W probably damaging Het
Als2 A G 1: 59,180,147 Y1215H probably damaging Het
Anks1b A T 10: 90,042,548 D73V probably damaging Het
Bpifb6 T C 2: 153,906,861 F259S probably damaging Het
Cenpv A T 11: 62,525,176 M249K probably benign Het
Ces1d C T 8: 93,186,118 V231I probably benign Het
Clasp1 G A 1: 118,504,959 V460I probably damaging Het
Cnot10 A T 9: 114,629,095 Y114* probably null Het
Cpb1 G T 3: 20,263,782 R193S probably benign Het
Ctc1 T C 11: 69,036,150 S1207P possibly damaging Het
Cttnbp2 T A 6: 18,435,433 K142M probably damaging Het
Dhrs7b T G 11: 60,851,891 D136E probably benign Het
Dnah7b T C 1: 46,290,646 S3217P probably damaging Het
Eif4g3 C T 4: 138,126,563 S480L probably benign Het
Enah A T 1: 181,917,197 probably null Het
Epx T C 11: 87,868,712 D517G probably damaging Het
Gabrg2 T A 11: 41,976,663 D43V probably damaging Het
Gdf9 A T 11: 53,437,511 E431D possibly damaging Het
Ghr T C 15: 3,320,574 D374G probably damaging Het
Gin1 A T 1: 97,786,150 I392F probably damaging Het
Grk4 T C 5: 34,731,538 V342A probably benign Het
Hhipl2 A T 1: 183,423,524 Y135F possibly damaging Het
Insig1 C T 5: 28,071,708 R91W probably damaging Het
Kcnf1 C G 12: 17,175,732 D163H probably benign Het
Kif11 A T 19: 37,387,200 K190* probably null Het
Ldb2 T G 5: 44,473,472 E309A probably damaging Het
Lipo4 T G 19: 33,512,673 D143A probably damaging Het
Map3k6 T G 4: 133,252,473 I1261S probably damaging Het
Mtus1 C T 8: 41,015,409 V27I possibly damaging Het
Ndufaf2 C T 13: 108,091,573 V60I probably benign Het
Nup133 A G 8: 123,949,035 F48L probably benign Het
Olfr1131 T A 2: 87,628,977 N171K probably benign Het
Olfr1357 G T 10: 78,612,140 T167N probably benign Het
Olfr1362 A C 13: 21,611,764 F68L probably benign Het
Pcdhb21 A T 18: 37,515,479 N554Y probably damaging Het
Pcx A T 19: 4,603,159 D284V possibly damaging Het
Pcyt1a T C 16: 32,467,119 S203P probably damaging Het
Pdlim3 A T 8: 45,896,859 I69F probably damaging Het
Pkp4 T C 2: 59,322,554 V598A probably benign Het
Plbd1 T C 6: 136,612,306 I509V probably benign Het
Polr3b C A 10: 84,652,783 T319N probably benign Het
Ptprj T C 2: 90,463,320 D380G probably benign Het
Ralgapa1 T G 12: 55,741,536 R587S probably damaging Het
Scn5a C A 9: 119,486,092 R1850L probably damaging Het
Ssc5d C A 7: 4,944,043 T1132K probably benign Het
Stard7 T A 2: 127,295,486 N285K possibly damaging Het
Tcp11l2 C T 10: 84,613,487 R439W probably damaging Het
Tecrl T C 5: 83,280,508 probably null Het
Tep1 A T 14: 50,824,563 L2570Q probably null Het
Tex14 A T 11: 87,554,928 D191V probably damaging Het
Tm7sf2 A G 19: 6,063,019 probably null Het
Tmem132e A G 11: 82,437,370 K408R probably benign Het
Tube1 A G 10: 39,144,766 D216G possibly damaging Het
Ubap2 C T 4: 41,199,872 A752T probably benign Het
Vmn2r82 A G 10: 79,379,419 H412R possibly damaging Het
Wtip T C 7: 34,116,595 E352G probably damaging Het
Xirp2 T A 2: 67,510,295 L960* probably null Het
Zc3h11a A C 1: 133,624,687 S561A probably benign Het
Zfhx2 A T 14: 55,062,985 D2436E probably damaging Het
Zfp763 T C 17: 33,019,907 H88R probably benign Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10555962 missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10522144 missense probably benign 0.01
IGL01563:Greb1l APN 18 10469399 missense probably damaging 0.99
IGL01944:Greb1l APN 18 10557280 missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10515271 missense probably damaging 1.00
IGL02249:Greb1l APN 18 10532961 missense probably damaging 1.00
IGL02318:Greb1l APN 18 10469388 missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10515200 missense probably damaging 0.99
IGL02516:Greb1l APN 18 10537064 missense probably benign 0.31
IGL02566:Greb1l APN 18 10503299 missense probably damaging 0.99
IGL02583:Greb1l APN 18 10542362 missense probably damaging 1.00
IGL02838:Greb1l APN 18 10560430 missense probably damaging 1.00
A4554:Greb1l UTSW 18 10532862 missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10533031 missense probably damaging 0.98
PIT4453001:Greb1l UTSW 18 10533032 missense probably benign 0.08
R0099:Greb1l UTSW 18 10509158 missense probably damaging 1.00
R0226:Greb1l UTSW 18 10522076 intron probably benign
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0239:Greb1l UTSW 18 10458567 splice site probably benign
R0316:Greb1l UTSW 18 10547420 missense probably damaging 1.00
R0369:Greb1l UTSW 18 10469375 missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10523374 missense probably damaging 0.99
R0478:Greb1l UTSW 18 10509281 missense probably damaging 1.00
R0555:Greb1l UTSW 18 10458781 splice site probably benign
R0671:Greb1l UTSW 18 10474303 missense probably damaging 1.00
R1282:Greb1l UTSW 18 10547289 missense probably benign 0.13
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1666:Greb1l UTSW 18 10501080 critical splice donor site probably null
R1666:Greb1l UTSW 18 10529708 critical splice donor site probably null
R1720:Greb1l UTSW 18 10553848 missense probably benign 0.19
R1808:Greb1l UTSW 18 10542143 missense probably benign
R1829:Greb1l UTSW 18 10509314 missense probably damaging 1.00
R1897:Greb1l UTSW 18 10498992 missense probably benign 0.00
R1967:Greb1l UTSW 18 10501049 missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10515221 missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10523281 missense probably damaging 1.00
R2125:Greb1l UTSW 18 10511422 missense probably damaging 0.98
R2139:Greb1l UTSW 18 10555011 missense probably damaging 1.00
R2255:Greb1l UTSW 18 10554857 missense probably damaging 1.00
R2256:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10547288 missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10542380 missense probably damaging 0.99
R3778:Greb1l UTSW 18 10469444 missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10522247 missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10515209 missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10522150 missense probably damaging 0.99
R4134:Greb1l UTSW 18 10529708 critical splice donor site probably null
R4342:Greb1l UTSW 18 10544561 missense probably benign 0.12
R4409:Greb1l UTSW 18 10503182 missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10553705 missense probably damaging 1.00
R4618:Greb1l UTSW 18 10498965 missense probably benign 0.00
R4683:Greb1l UTSW 18 10529563 splice site probably null
R4686:Greb1l UTSW 18 10522112 missense probably damaging 0.98
R4707:Greb1l UTSW 18 10532922 missense probably benign 0.02
R4780:Greb1l UTSW 18 10541792 missense probably benign 0.00
R4819:Greb1l UTSW 18 10458358 missense probably damaging 1.00
R4925:Greb1l UTSW 18 10547447 missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10547306 missense probably damaging 0.99
R5150:Greb1l UTSW 18 10555950 frame shift probably null
R5154:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5269:Greb1l UTSW 18 10511409 missense probably benign
R5290:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5310:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5328:Greb1l UTSW 18 10553720 missense probably damaging 1.00
R5337:Greb1l UTSW 18 10509143 missense probably damaging 1.00
R5393:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5402:Greb1l UTSW 18 10537169 missense probably benign 0.26
R5718:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5719:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5720:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5721:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5902:Greb1l UTSW 18 10538302 missense probably benign 0.00
R5993:Greb1l UTSW 18 10544455 missense probably benign 0.10
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10547068 missense probably damaging 1.00
R6063:Greb1l UTSW 18 10557340 missense probably damaging 1.00
R6297:Greb1l UTSW 18 10469494 missense probably damaging 1.00
R6405:Greb1l UTSW 18 10501076 missense probably benign 0.30
R6552:Greb1l UTSW 18 10541814 missense probably benign 0.00
R6572:Greb1l UTSW 18 10522131 missense probably benign 0.07
R6575:Greb1l UTSW 18 10547347 missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10547482 missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10558786 missense probably benign 0.23
R6962:Greb1l UTSW 18 10547327 missense probably damaging 1.00
R7012:Greb1l UTSW 18 10529707 critical splice donor site probably null
R7179:Greb1l UTSW 18 10544576 missense probably benign 0.00
R7251:Greb1l UTSW 18 10515319 missense probably damaging 1.00
R7275:Greb1l UTSW 18 10544561 missense probably benign 0.12
R7301:Greb1l UTSW 18 10544970 missense probably damaging 1.00
R7307:Greb1l UTSW 18 10538142 missense probably damaging 0.99
R7455:Greb1l UTSW 18 10554915 missense probably damaging 1.00
R7832:Greb1l UTSW 18 10542056 missense probably benign 0.38
R7934:Greb1l UTSW 18 10474371 nonsense probably null
R8137:Greb1l UTSW 18 10474357 missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10533060 missense probably benign 0.13
R8208:Greb1l UTSW 18 10510703 missense probably damaging 1.00
R8227:Greb1l UTSW 18 10515371 missense probably damaging 1.00
R8312:Greb1l UTSW 18 10511587 intron probably benign
R8331:Greb1l UTSW 18 10458706 missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10529687 missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10529613 missense probably benign 0.00
R8695:Greb1l UTSW 18 10544450 missense probably benign 0.01
R8795:Greb1l UTSW 18 10553739 missense probably damaging 0.98
R8836:Greb1l UTSW 18 10509257 missense probably benign 0.30
R8862:Greb1l UTSW 18 10555042 missense possibly damaging 0.90
R8872:Greb1l UTSW 18 10529684 missense probably benign 0.18
R8874:Greb1l UTSW 18 10544896 missense probably benign 0.01
R8886:Greb1l UTSW 18 10553843 missense probably benign 0.21
R8921:Greb1l UTSW 18 10541825 missense probably benign 0.01
R8997:Greb1l UTSW 18 10510747 missense probably damaging 1.00
R9015:Greb1l UTSW 18 10541675 missense probably benign 0.00
R9018:Greb1l UTSW 18 10542004 missense possibly damaging 0.76
R9074:Greb1l UTSW 18 10532797 missense probably damaging 1.00
R9074:Greb1l UTSW 18 10558795 missense probably damaging 1.00
R9117:Greb1l UTSW 18 10542422 missense probably benign 0.31
R9189:Greb1l UTSW 18 10499983 missense probably benign
R9332:Greb1l UTSW 18 10532796 missense possibly damaging 0.92
R9367:Greb1l UTSW 18 10522130 missense probably benign 0.00
R9497:Greb1l UTSW 18 10458600 missense probably benign 0.00
R9796:Greb1l UTSW 18 10538233 missense possibly damaging 0.69
Z1176:Greb1l UTSW 18 10515305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTGGTGTCAAGTTCACAGCCGC -3'
(R):5'- TCTTCTTGGAGGGCTACCCGAAAC -3'

Sequencing Primer
(F):5'- AAGTTCACAGCCGCTTCCC -3'
(R):5'- TACCCGAAACCCGTGGTAG -3'
Posted On 2014-04-24