Mutagenetix > Incidental Mutation

Incidental Mutation 'R1608:Slc40a1'

176596

Institutional Source

Beutler Lab

Gene Symbol

Slc40a1

Ensembl Gene

ENSMUSG00000025993

Gene Name

solute carrier family 40 (iron-regulated transporter), member 1

Synonyms

Dusg, metal transporting protein 1, Ol5, ferroportin1, IREG1, Slc11a3, FPN1, Pcm, MTP1

MMRRC Submission

039645-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1608 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

45908068-45926523 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 45911297 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 332 (A332T)

Ref Sequence

ENSEMBL: ENSMUSP00000027137 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027137]

AlphaFold

Q9JHI9

Predicted Effect

probably damaging
Transcript: ENSMUST00000027137
AA Change: A332T

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000027137
Gene: ENSMUSG00000025993
AA Change: A332T

Domain	Start	End	E-Value	Type
Pfam:FPN1	22	530	5e-194	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190055

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191247

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 89.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell membrane protein that may be involved in iron export from duodenal epithelial cells. Defects in this gene are a cause of hemochromatosis type 4 (HFE4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit embryonic lethality before embryo turning. Mice heterozygous for a targeted mutation display decreased thermal response latency. Mice heterozygous for an ENU induced mutation display abnormal iron homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts15	A	G	9: 30,902,479	S797P	probably damaging	Het
Akap9	T	C	5: 3,961,783	Y829H	probably damaging	Het
Anp32a	A	G	9: 62,372,093	D74G	probably damaging	Het
B230118H07Rik	T	C	2: 101,610,571	E29G	probably damaging	Het
B3gat1	T	C	9: 26,751,816	I13T	probably damaging	Het
Cbfa2t3	A	T	8: 122,647,709	V99D	probably damaging	Het
Celsr2	C	T	3: 108,402,483	C1600Y	probably damaging	Het
Ddx31	T	A	2: 28,859,066	N291K	probably damaging	Het
Dennd1a	T	G	2: 37,852,434	M3L	probably benign	Het
Dnah12	C	T	14: 26,766,190	P1017L	probably damaging	Het
Dnajc6	A	T	4: 101,599,167	D86V	probably damaging	Het
Evx2	T	G	2: 74,657,851	K208N	probably damaging	Het
F13a1	A	G	13: 36,868,811	V718A	probably damaging	Het
Fcho2	T	C	13: 98,726,198	D757G	probably benign	Het
Fmnl2	A	G	2: 53,105,537	E424G	probably damaging	Het
Fryl	C	T	5: 73,074,751	W424*	probably null	Het
Gata3	G	T	2: 9,874,768	Y97*	probably null	Het
Gm15446	T	A	5: 109,942,457	C192S	probably damaging	Het
Hdac10	A	T	15: 89,125,318	D470E	probably benign	Het
Ier2	A	G	8: 84,662,426	L109P	probably benign	Het
Kcnh2	T	C	5: 24,322,219	T559A	probably benign	Het
Khk	C	T	5: 30,930,594	A204V	probably damaging	Het
Kndc1	T	A	7: 139,927,408	M1169K	possibly damaging	Het
Krtap31-1	A	G	11: 99,908,093	S41G	probably benign	Het
Nabp1	T	C	1: 51,473,003		probably null	Het
Nphp3	A	G	9: 104,035,840	D939G	probably benign	Het
Olfr513	A	T	7: 108,755,102	N82I	probably damaging	Het
Plcg2	T	C	8: 117,614,235	I1089T	possibly damaging	Het
Ptk2	A	T	15: 73,262,575	D558E	probably damaging	Het
Serpinb6d	A	G	13: 33,669,129	D168G	probably benign	Het
Shisa8	G	A	15: 82,208,555	P189L	probably damaging	Het
Shkbp1	A	G	7: 27,354,779	V89A	probably benign	Het
Slc44a3	A	T	3: 121,497,847	Y373*	probably null	Het
Slf2	T	C	19: 44,949,001	V722A	probably benign	Het
Spanxn4	A	G	12: 62,687,838		noncoding transcript	Het
Stag3	T	A	5: 138,298,639		probably null	Het
Tanc1	T	C	2: 59,797,694	I612T	possibly damaging	Het
Thbs2	T	A	17: 14,685,781	M286L	probably benign	Het
Top1	T	A	2: 160,703,595	N294K	probably benign	Het
Tpr	T	G	1: 150,426,893	L1381V	probably damaging	Het
Trpm8	T	G	1: 88,326,432	S126A	probably benign	Het
Ttc41	A	G	10: 86,775,993	Y1075C	probably damaging	Het
Ubox5	C	T	2: 130,597,456	G418D	probably benign	Het
Vmn1r67	T	C	7: 10,446,980	V57A	possibly damaging	Het
Zbtb5	T	C	4: 44,993,500	H628R	probably damaging	Het
Zfp810	T	C	9: 22,278,920	I231V	probably benign	Het

Other mutations in Slc40a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01548:Slc40a1	APN	1	45909492	missense	probably benign	0.19
IGL01576:Slc40a1	APN	1	45909597	missense	probably damaging	1.00
IGL02113:Slc40a1	APN	1	45910894	missense	probably benign	0.33
IGL02116:Slc40a1	APN	1	45911528	missense	probably benign	0.01
IGL02220:Slc40a1	APN	1	45911335	missense	probably damaging	1.00
IGL02537:Slc40a1	APN	1	45911393	missense	probably benign	0.01
IGL02574:Slc40a1	APN	1	45912374	missense	possibly damaging	0.77
IGL02673:Slc40a1	APN	1	45918416	missense	possibly damaging	0.82
IGL02794:Slc40a1	APN	1	45909508	nonsense	probably null
R0376:Slc40a1	UTSW	1	45912491	splice site	probably benign
R0417:Slc40a1	UTSW	1	45911374	missense	possibly damaging	0.50
R1723:Slc40a1	UTSW	1	45924761	missense	probably damaging	1.00
R1892:Slc40a1	UTSW	1	45911142	nonsense	probably null
R2092:Slc40a1	UTSW	1	45909454	missense	probably benign
R2303:Slc40a1	UTSW	1	45910884	splice site	probably benign
R2365:Slc40a1	UTSW	1	45924713	splice site	probably null
R3718:Slc40a1	UTSW	1	45910991	missense	probably benign
R4689:Slc40a1	UTSW	1	45912313	missense	probably benign	0.00
R4994:Slc40a1	UTSW	1	45909664	missense	probably damaging	1.00
R5103:Slc40a1	UTSW	1	45918995	nonsense	probably null
R5151:Slc40a1	UTSW	1	45911356	missense	possibly damaging	0.84
R5364:Slc40a1	UTSW	1	45925223	missense	probably damaging	0.96
R5404:Slc40a1	UTSW	1	45912328	missense	probably damaging	1.00
R5531:Slc40a1	UTSW	1	45912338	missense	probably damaging	1.00
R5841:Slc40a1	UTSW	1	45912349	missense	probably damaging	1.00
R6440:Slc40a1	UTSW	1	45925262	start codon destroyed	probably null	0.94
R6455:Slc40a1	UTSW	1	45918947	missense	probably damaging	0.99
R6975:Slc40a1	UTSW	1	45909492	missense	probably benign	0.19
R7085:Slc40a1	UTSW	1	45911528	missense	probably benign
R7130:Slc40a1	UTSW	1	45921224	missense	probably damaging	1.00
R7502:Slc40a1	UTSW	1	45918974	missense	probably damaging	1.00
R7755:Slc40a1	UTSW	1	45911306	missense	probably damaging	0.99
R8085:Slc40a1	UTSW	1	45918368	missense	probably damaging	1.00
R8218:Slc40a1	UTSW	1	45910969	missense	probably benign	0.03
R8308:Slc40a1	UTSW	1	45911020	missense	probably benign	0.02
R8333:Slc40a1	UTSW	1	45911279	missense	probably damaging	0.97
R8427:Slc40a1	UTSW	1	45912338	missense	probably damaging	1.00
R8493:Slc40a1	UTSW	1	45911416	missense	probably damaging	0.98
R8515:Slc40a1	UTSW	1	45912307	missense	probably damaging	0.99
R8817:Slc40a1	UTSW	1	45909539	missense	probably damaging	1.00
R8981:Slc40a1	UTSW	1	45909420	missense	probably benign
R8987:Slc40a1	UTSW	1	45911335	missense	probably damaging	1.00
R9042:Slc40a1	UTSW	1	45909461	missense	probably benign	0.31
R9183:Slc40a1	UTSW	1	45909511	missense	possibly damaging	0.92
R9242:Slc40a1	UTSW	1	45910969	missense	probably benign
R9522:Slc40a1	UTSW	1	45909512	missense	probably damaging	1.00
R9582:Slc40a1	UTSW	1	45911339	missense	probably damaging	1.00
R9783:Slc40a1	UTSW	1	45912353	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTAGCAGCAATGACTCCTGCAAAC -3'
(R):5'- TGAATGTGAACAAGAGCCCACCTG -3'

Sequencing Primer
(F):5'- GGGCTTCCAGGCATGAATAC -3'
(R):5'- ACCTGTGCCTCCCAGATG -3'

Posted On

2014-04-24