Incidental Mutation 'R1608:Nabp1'
Institutional Source Beutler Lab
Gene Symbol Nabp1
Ensembl Gene ENSMUSG00000026107
Gene Namenucleic acid binding protein 1
Synonyms4933440J18Rik, Nbp1, 4930442A21Rik, Obfc2a, 4930434H03Rik, Ssb2, 5830411E10Rik, 4930488J04Rik
MMRRC Submission 039645-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R1608 (G1)
Quality Score225
Status Not validated
Chromosomal Location51465862-51478425 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 51473003 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027279] [ENSMUST00000027279] [ENSMUST00000185534] [ENSMUST00000185534] [ENSMUST00000185534] [ENSMUST00000185534] [ENSMUST00000186003] [ENSMUST00000186003] [ENSMUST00000186684] [ENSMUST00000186684] [ENSMUST00000186684] [ENSMUST00000186684] [ENSMUST00000188051] [ENSMUST00000188051] [ENSMUST00000188051] [ENSMUST00000188051] [ENSMUST00000188204] [ENSMUST00000188204] [ENSMUST00000188204] [ENSMUST00000188204] [ENSMUST00000189542] [ENSMUST00000189542] [ENSMUST00000190103] [ENSMUST00000190103]
AlphaFold Q8BGW5
Predicted Effect probably null
Transcript: ENSMUST00000027279
SMART Domains Protein: ENSMUSP00000027279
Gene: ENSMUSG00000026107

PDB:4OWX|B 10 142 2e-72 PDB
SCOP:d1fgua1 11 84 3e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000027279
SMART Domains Protein: ENSMUSP00000027279
Gene: ENSMUSG00000026107

PDB:4OWX|B 10 142 2e-72 PDB
SCOP:d1fgua1 11 84 3e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000185534
SMART Domains Protein: ENSMUSP00000140557
Gene: ENSMUSG00000026107

PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000185534
SMART Domains Protein: ENSMUSP00000140557
Gene: ENSMUSG00000026107

PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000185534
SMART Domains Protein: ENSMUSP00000140557
Gene: ENSMUSG00000026107

PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000185534
SMART Domains Protein: ENSMUSP00000140557
Gene: ENSMUSG00000026107

PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185961
Predicted Effect probably benign
Transcript: ENSMUST00000186003
SMART Domains Protein: ENSMUSP00000140126
Gene: ENSMUSG00000026107

PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000186003
SMART Domains Protein: ENSMUSP00000140126
Gene: ENSMUSG00000026107

PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000186684
SMART Domains Protein: ENSMUSP00000140179
Gene: ENSMUSG00000026107

PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000186684
SMART Domains Protein: ENSMUSP00000140179
Gene: ENSMUSG00000026107

PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000186684
SMART Domains Protein: ENSMUSP00000140179
Gene: ENSMUSG00000026107

PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000186684
SMART Domains Protein: ENSMUSP00000140179
Gene: ENSMUSG00000026107

PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000188051
SMART Domains Protein: ENSMUSP00000139853
Gene: ENSMUSG00000026107

PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000188051
SMART Domains Protein: ENSMUSP00000139853
Gene: ENSMUSG00000026107

PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000188051
SMART Domains Protein: ENSMUSP00000139853
Gene: ENSMUSG00000026107

PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000188051
SMART Domains Protein: ENSMUSP00000139853
Gene: ENSMUSG00000026107

PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000188204
SMART Domains Protein: ENSMUSP00000140469
Gene: ENSMUSG00000026107

PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000188204
SMART Domains Protein: ENSMUSP00000140469
Gene: ENSMUSG00000026107

PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000188204
SMART Domains Protein: ENSMUSP00000140469
Gene: ENSMUSG00000026107

PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000188204
SMART Domains Protein: ENSMUSP00000140469
Gene: ENSMUSG00000026107

PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188303
Predicted Effect probably benign
Transcript: ENSMUST00000189542
SMART Domains Protein: ENSMUSP00000140059
Gene: ENSMUSG00000026107

PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000189542
SMART Domains Protein: ENSMUSP00000140059
Gene: ENSMUSG00000026107

PDB:4OWX|B 1 62 2e-24 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000190103
SMART Domains Protein: ENSMUSP00000140556
Gene: ENSMUSG00000026107

Pfam:tRNA_anti-codon 27 108 2.8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190103
SMART Domains Protein: ENSMUSP00000140556
Gene: ENSMUSG00000026107

Pfam:tRNA_anti-codon 27 108 2.8e-7 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Single-stranded DNA (ssDNA)-binding proteins, such as OBFC2A, are ubiquitous and essential for a variety of DNA metabolic processes, including replication, recombination, and detection and repair of damage (Richard et al., 2008 [PubMed 18449195]).[supplied by OMIM, Jun 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 A G 9: 30,902,479 S797P probably damaging Het
Akap9 T C 5: 3,961,783 Y829H probably damaging Het
Anp32a A G 9: 62,372,093 D74G probably damaging Het
B230118H07Rik T C 2: 101,610,571 E29G probably damaging Het
B3gat1 T C 9: 26,751,816 I13T probably damaging Het
Cbfa2t3 A T 8: 122,647,709 V99D probably damaging Het
Celsr2 C T 3: 108,402,483 C1600Y probably damaging Het
Ddx31 T A 2: 28,859,066 N291K probably damaging Het
Dennd1a T G 2: 37,852,434 M3L probably benign Het
Dnah12 C T 14: 26,766,190 P1017L probably damaging Het
Dnajc6 A T 4: 101,599,167 D86V probably damaging Het
Evx2 T G 2: 74,657,851 K208N probably damaging Het
F13a1 A G 13: 36,868,811 V718A probably damaging Het
Fcho2 T C 13: 98,726,198 D757G probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Fryl C T 5: 73,074,751 W424* probably null Het
Gata3 G T 2: 9,874,768 Y97* probably null Het
Gm15446 T A 5: 109,942,457 C192S probably damaging Het
Hdac10 A T 15: 89,125,318 D470E probably benign Het
Ier2 A G 8: 84,662,426 L109P probably benign Het
Kcnh2 T C 5: 24,322,219 T559A probably benign Het
Khk C T 5: 30,930,594 A204V probably damaging Het
Kndc1 T A 7: 139,927,408 M1169K possibly damaging Het
Krtap31-1 A G 11: 99,908,093 S41G probably benign Het
Nphp3 A G 9: 104,035,840 D939G probably benign Het
Olfr513 A T 7: 108,755,102 N82I probably damaging Het
Plcg2 T C 8: 117,614,235 I1089T possibly damaging Het
Ptk2 A T 15: 73,262,575 D558E probably damaging Het
Serpinb6d A G 13: 33,669,129 D168G probably benign Het
Shisa8 G A 15: 82,208,555 P189L probably damaging Het
Shkbp1 A G 7: 27,354,779 V89A probably benign Het
Slc40a1 C T 1: 45,911,297 A332T probably damaging Het
Slc44a3 A T 3: 121,497,847 Y373* probably null Het
Slf2 T C 19: 44,949,001 V722A probably benign Het
Spanxn4 A G 12: 62,687,838 noncoding transcript Het
Stag3 T A 5: 138,298,639 probably null Het
Tanc1 T C 2: 59,797,694 I612T possibly damaging Het
Thbs2 T A 17: 14,685,781 M286L probably benign Het
Top1 T A 2: 160,703,595 N294K probably benign Het
Tpr T G 1: 150,426,893 L1381V probably damaging Het
Trpm8 T G 1: 88,326,432 S126A probably benign Het
Ttc41 A G 10: 86,775,993 Y1075C probably damaging Het
Ubox5 C T 2: 130,597,456 G418D probably benign Het
Vmn1r67 T C 7: 10,446,980 V57A possibly damaging Het
Zbtb5 T C 4: 44,993,500 H628R probably damaging Het
Zfp810 T C 9: 22,278,920 I231V probably benign Het
Other mutations in Nabp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Nabp1 APN 1 51477528 missense probably damaging 1.00
kinkajou UTSW 1 51471352 missense possibly damaging 0.70
R0898:Nabp1 UTSW 1 51471337 missense probably benign
R1614:Nabp1 UTSW 1 51471352 missense possibly damaging 0.70
R1956:Nabp1 UTSW 1 51477845 missense probably damaging 0.96
R2208:Nabp1 UTSW 1 51477614 nonsense probably null
R4632:Nabp1 UTSW 1 51474602 nonsense probably null
R5996:Nabp1 UTSW 1 51471385 missense probably benign 0.00
R6754:Nabp1 UTSW 1 51474540 missense probably damaging 0.97
R7322:Nabp1 UTSW 1 51473070 missense probably damaging 0.98
R8251:Nabp1 UTSW 1 51477578 missense probably benign 0.04
R8302:Nabp1 UTSW 1 51472339 missense probably benign 0.00
X0063:Nabp1 UTSW 1 51477849 missense probably benign 0.00
Z1176:Nabp1 UTSW 1 51477725 intron probably benign
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- aatttcttatcctatttccaacctcc -3'
Posted On2014-04-24