Mutagenetix > Incidental Mutation

Incidental Mutation 'R1608:Trpm8'

176598

Institutional Source

Beutler Lab

Gene Symbol

Trpm8

Ensembl Gene

ENSMUSG00000036251

Gene Name

transient receptor potential cation channel, subfamily M, member 8

Synonyms

CMR1, Trp-p8, TRPP8

MMRRC Submission

039645-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.248) question?

Stock #

R1608 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

88277661-88389293 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 88326432 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 126 (S126A)

Ref Sequence

ENSEMBL: ENSMUSP00000131209 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040210] [ENSMUST00000113114] [ENSMUST00000171176]

AlphaFold

Q8R4D5

Predicted Effect

probably benign
Transcript: ENSMUST00000040210
AA Change: S126A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000036991
Gene: ENSMUSG00000036251
AA Change: S126A

Domain	Start	End	E-Value	Type
low complexity region	25	40	N/A	INTRINSIC
transmembrane domain	693	712	N/A	INTRINSIC
transmembrane domain	724	758	N/A	INTRINSIC
Pfam:Ion_trans	769	979	4.7e-10	PFAM
low complexity region	1026	1036	N/A	INTRINSIC
coiled coil region	1069	1104	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113114
AA Change: S126A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000108739
Gene: ENSMUSG00000036251
AA Change: S126A

Domain	Start	End	E-Value	Type
low complexity region	25	40	N/A	INTRINSIC
transmembrane domain	693	712	N/A	INTRINSIC
transmembrane domain	724	758	N/A	INTRINSIC
Pfam:Ion_trans	769	979	4.7e-10	PFAM
low complexity region	1026	1036	N/A	INTRINSIC
coiled coil region	1069	1104	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000171176
AA Change: S126A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000131209
Gene: ENSMUSG00000036251
AA Change: S126A

Domain	Start	End	E-Value	Type
low complexity region	25	40	N/A	INTRINSIC
transmembrane domain	693	712	N/A	INTRINSIC
transmembrane domain	724	758	N/A	INTRINSIC
transmembrane domain	763	780	N/A	INTRINSIC
transmembrane domain	793	815	N/A	INTRINSIC
transmembrane domain	825	847	N/A	INTRINSIC
transmembrane domain	867	889	N/A	INTRINSIC
transmembrane domain	954	976	N/A	INTRINSIC
low complexity region	1026	1036	N/A	INTRINSIC
coiled coil region	1069	1104	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 89.7%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to cold and reduced response to cold stimuli. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts15	A	G	9: 30,902,479	S797P	probably damaging	Het
Akap9	T	C	5: 3,961,783	Y829H	probably damaging	Het
Anp32a	A	G	9: 62,372,093	D74G	probably damaging	Het
B230118H07Rik	T	C	2: 101,610,571	E29G	probably damaging	Het
B3gat1	T	C	9: 26,751,816	I13T	probably damaging	Het
Cbfa2t3	A	T	8: 122,647,709	V99D	probably damaging	Het
Celsr2	C	T	3: 108,402,483	C1600Y	probably damaging	Het
Ddx31	T	A	2: 28,859,066	N291K	probably damaging	Het
Dennd1a	T	G	2: 37,852,434	M3L	probably benign	Het
Dnah12	C	T	14: 26,766,190	P1017L	probably damaging	Het
Dnajc6	A	T	4: 101,599,167	D86V	probably damaging	Het
Evx2	T	G	2: 74,657,851	K208N	probably damaging	Het
F13a1	A	G	13: 36,868,811	V718A	probably damaging	Het
Fcho2	T	C	13: 98,726,198	D757G	probably benign	Het
Fmnl2	A	G	2: 53,105,537	E424G	probably damaging	Het
Fryl	C	T	5: 73,074,751	W424*	probably null	Het
Gata3	G	T	2: 9,874,768	Y97*	probably null	Het
Gm15446	T	A	5: 109,942,457	C192S	probably damaging	Het
Hdac10	A	T	15: 89,125,318	D470E	probably benign	Het
Ier2	A	G	8: 84,662,426	L109P	probably benign	Het
Kcnh2	T	C	5: 24,322,219	T559A	probably benign	Het
Khk	C	T	5: 30,930,594	A204V	probably damaging	Het
Kndc1	T	A	7: 139,927,408	M1169K	possibly damaging	Het
Krtap31-1	A	G	11: 99,908,093	S41G	probably benign	Het
Nabp1	T	C	1: 51,473,003		probably null	Het
Nphp3	A	G	9: 104,035,840	D939G	probably benign	Het
Olfr513	A	T	7: 108,755,102	N82I	probably damaging	Het
Plcg2	T	C	8: 117,614,235	I1089T	possibly damaging	Het
Ptk2	A	T	15: 73,262,575	D558E	probably damaging	Het
Serpinb6d	A	G	13: 33,669,129	D168G	probably benign	Het
Shisa8	G	A	15: 82,208,555	P189L	probably damaging	Het
Shkbp1	A	G	7: 27,354,779	V89A	probably benign	Het
Slc40a1	C	T	1: 45,911,297	A332T	probably damaging	Het
Slc44a3	A	T	3: 121,497,847	Y373*	probably null	Het
Slf2	T	C	19: 44,949,001	V722A	probably benign	Het
Spanxn4	A	G	12: 62,687,838		noncoding transcript	Het
Stag3	T	A	5: 138,298,639		probably null	Het
Tanc1	T	C	2: 59,797,694	I612T	possibly damaging	Het
Thbs2	T	A	17: 14,685,781	M286L	probably benign	Het
Top1	T	A	2: 160,703,595	N294K	probably benign	Het
Tpr	T	G	1: 150,426,893	L1381V	probably damaging	Het
Ttc41	A	G	10: 86,775,993	Y1075C	probably damaging	Het
Ubox5	C	T	2: 130,597,456	G418D	probably benign	Het
Vmn1r67	T	C	7: 10,446,980	V57A	possibly damaging	Het
Zbtb5	T	C	4: 44,993,500	H628R	probably damaging	Het
Zfp810	T	C	9: 22,278,920	I231V	probably benign	Het

Other mutations in Trpm8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00963:Trpm8	APN	1	88379827	missense	possibly damaging	0.82
IGL01387:Trpm8	APN	1	88343287	missense	probably damaging	1.00
IGL01933:Trpm8	APN	1	88326405	missense	probably damaging	0.98
IGL02075:Trpm8	APN	1	88325488	missense	probably damaging	1.00
IGL02184:Trpm8	APN	1	88330694	critical splice acceptor site	probably null
IGL02342:Trpm8	APN	1	88328250	missense	possibly damaging	0.58
IGL02416:Trpm8	APN	1	88360716	missense	probably damaging	1.00
IGL02696:Trpm8	APN	1	88348051	missense	probably damaging	1.00
IGL02807:Trpm8	APN	1	88348108	missense	probably damaging	1.00
R0078:Trpm8	UTSW	1	88328148	splice site	probably benign
R1183:Trpm8	UTSW	1	88348091	missense	probably damaging	1.00
R1713:Trpm8	UTSW	1	88365080	missense	probably damaging	1.00
R1724:Trpm8	UTSW	1	88350856	missense	possibly damaging	0.86
R1966:Trpm8	UTSW	1	88332748	splice site	probably null
R2089:Trpm8	UTSW	1	88343326	missense	probably damaging	0.99
R2091:Trpm8	UTSW	1	88343326	missense	probably damaging	0.99
R2091:Trpm8	UTSW	1	88343326	missense	probably damaging	0.99
R2384:Trpm8	UTSW	1	88359656	missense	probably benign	0.00
R2475:Trpm8	UTSW	1	88354449	missense	probably damaging	1.00
R3726:Trpm8	UTSW	1	88328196	missense	probably benign	0.00
R3745:Trpm8	UTSW	1	88348327	missense	probably benign	0.21
R4063:Trpm8	UTSW	1	88362005	missense	probably damaging	1.00
R4678:Trpm8	UTSW	1	88337129	missense	probably benign	0.07
R4681:Trpm8	UTSW	1	88384705	missense	possibly damaging	0.63
R5031:Trpm8	UTSW	1	88348188	missense	probably benign	0.00
R5620:Trpm8	UTSW	1	88359651	critical splice acceptor site	probably null
R5644:Trpm8	UTSW	1	88359739	missense	possibly damaging	0.54
R5734:Trpm8	UTSW	1	88355280	missense	probably benign	0.01
R5839:Trpm8	UTSW	1	88325506	missense	possibly damaging	0.57
R5844:Trpm8	UTSW	1	88384711	makesense	probably null
R5845:Trpm8	UTSW	1	88328180	missense	probably benign	0.00
R5926:Trpm8	UTSW	1	88330747	missense	probably damaging	0.99
R5940:Trpm8	UTSW	1	88351415	nonsense	probably null
R6031:Trpm8	UTSW	1	88354469	missense	possibly damaging	0.95
R6031:Trpm8	UTSW	1	88354469	missense	possibly damaging	0.95
R6088:Trpm8	UTSW	1	88306678	start gained	probably benign
R6283:Trpm8	UTSW	1	88348332	missense	probably benign	0.09
R6299:Trpm8	UTSW	1	88354479	missense	probably damaging	1.00
R6367:Trpm8	UTSW	1	88359683	missense	probably damaging	1.00
R6526:Trpm8	UTSW	1	88361998	missense	probably damaging	0.98
R6682:Trpm8	UTSW	1	88326502	missense	probably damaging	0.96
R6751:Trpm8	UTSW	1	88384706	missense	possibly damaging	0.63
R7057:Trpm8	UTSW	1	88362080	missense	probably null	0.99
R7489:Trpm8	UTSW	1	88379759	missense	possibly damaging	0.85
R7520:Trpm8	UTSW	1	88343321	missense	probably benign	0.00
R7597:Trpm8	UTSW	1	88328196	missense	probably damaging	0.97
R7774:Trpm8	UTSW	1	88330841	missense	probably damaging	0.99
R7839:Trpm8	UTSW	1	88326454	missense	possibly damaging	0.83
R7948:Trpm8	UTSW	1	88374369	nonsense	probably null
R8176:Trpm8	UTSW	1	88365115	missense	probably benign	0.06
R8222:Trpm8	UTSW	1	88325668	splice site	probably null
R8946:Trpm8	UTSW	1	88348339	splice site	probably benign
R9121:Trpm8	UTSW	1	88384701	missense	probably benign	0.17
R9290:Trpm8	UTSW	1	88319045	missense	probably damaging	1.00
R9564:Trpm8	UTSW	1	88326436	missense	possibly damaging	0.55

Predicted Primers

PCR Primer
(F):5'- TTGTGGCACCATTCAGGATTGCCC -3'
(R):5'- CAAGATGCAGTGCAGAATGACCCC -3'

Sequencing Primer
(F):5'- ATTCAGGATTGCCCTCCCC -3'
(R):5'- TGCGTGGCTTCAAAGCAA -3'

Posted On

2014-04-24