Incidental Mutation 'R1608:Trpm8'
ID 176598
Institutional Source Beutler Lab
Gene Symbol Trpm8
Ensembl Gene ENSMUSG00000036251
Gene Name transient receptor potential cation channel, subfamily M, member 8
Synonyms Trp-p8, TRPP8, CMR1
MMRRC Submission 039645-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.311) question?
Stock # R1608 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 88234457-88318909 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 88254154 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 126 (S126A)
Ref Sequence ENSEMBL: ENSMUSP00000131209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040210] [ENSMUST00000113114] [ENSMUST00000171176]
AlphaFold Q8R4D5
Predicted Effect probably benign
Transcript: ENSMUST00000040210
AA Change: S126A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036991
Gene: ENSMUSG00000036251
AA Change: S126A

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
transmembrane domain 693 712 N/A INTRINSIC
transmembrane domain 724 758 N/A INTRINSIC
Pfam:Ion_trans 769 979 4.7e-10 PFAM
low complexity region 1026 1036 N/A INTRINSIC
coiled coil region 1069 1104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113114
AA Change: S126A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108739
Gene: ENSMUSG00000036251
AA Change: S126A

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
transmembrane domain 693 712 N/A INTRINSIC
transmembrane domain 724 758 N/A INTRINSIC
Pfam:Ion_trans 769 979 4.7e-10 PFAM
low complexity region 1026 1036 N/A INTRINSIC
coiled coil region 1069 1104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171176
AA Change: S126A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131209
Gene: ENSMUSG00000036251
AA Change: S126A

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
transmembrane domain 693 712 N/A INTRINSIC
transmembrane domain 724 758 N/A INTRINSIC
transmembrane domain 763 780 N/A INTRINSIC
transmembrane domain 793 815 N/A INTRINSIC
transmembrane domain 825 847 N/A INTRINSIC
transmembrane domain 867 889 N/A INTRINSIC
transmembrane domain 954 976 N/A INTRINSIC
low complexity region 1026 1036 N/A INTRINSIC
coiled coil region 1069 1104 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to cold and reduced response to cold stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 A G 9: 30,813,775 (GRCm39) S797P probably damaging Het
Akap9 T C 5: 4,011,783 (GRCm39) Y829H probably damaging Het
Anp32a A G 9: 62,279,375 (GRCm39) D74G probably damaging Het
B3gat1 T C 9: 26,663,112 (GRCm39) I13T probably damaging Het
Cbfa2t3 A T 8: 123,374,448 (GRCm39) V99D probably damaging Het
Celsr2 C T 3: 108,309,799 (GRCm39) C1600Y probably damaging Het
Ddx31 T A 2: 28,749,078 (GRCm39) N291K probably damaging Het
Dennd1a T G 2: 37,742,446 (GRCm39) M3L probably benign Het
Dnah12 C T 14: 26,488,147 (GRCm39) P1017L probably damaging Het
Dnajc6 A T 4: 101,456,364 (GRCm39) D86V probably damaging Het
Evx2 T G 2: 74,488,195 (GRCm39) K208N probably damaging Het
F13a1 A G 13: 37,052,785 (GRCm39) V718A probably damaging Het
Fcho2 T C 13: 98,862,706 (GRCm39) D757G probably benign Het
Fmnl2 A G 2: 52,995,549 (GRCm39) E424G probably damaging Het
Fryl C T 5: 73,232,094 (GRCm39) W424* probably null Het
Gata3 G T 2: 9,879,579 (GRCm39) Y97* probably null Het
Gm15446 T A 5: 110,090,323 (GRCm39) C192S probably damaging Het
Hdac10 A T 15: 89,009,521 (GRCm39) D470E probably benign Het
Ier2 A G 8: 85,389,055 (GRCm39) L109P probably benign Het
Iftap T C 2: 101,440,916 (GRCm39) E29G probably damaging Het
Kcnh2 T C 5: 24,527,217 (GRCm39) T559A probably benign Het
Khk C T 5: 31,087,938 (GRCm39) A204V probably damaging Het
Kndc1 T A 7: 139,507,321 (GRCm39) M1169K possibly damaging Het
Krtap31-1 A G 11: 99,798,919 (GRCm39) S41G probably benign Het
Nabp1 T C 1: 51,512,162 (GRCm39) probably null Het
Nphp3 A G 9: 103,913,039 (GRCm39) D939G probably benign Het
Or5e1 A T 7: 108,354,309 (GRCm39) N82I probably damaging Het
Plcg2 T C 8: 118,340,974 (GRCm39) I1089T possibly damaging Het
Ptk2 A T 15: 73,134,424 (GRCm39) D558E probably damaging Het
Serpinb6d A G 13: 33,853,112 (GRCm39) D168G probably benign Het
Shisa8 G A 15: 82,092,756 (GRCm39) P189L probably damaging Het
Shkbp1 A G 7: 27,054,204 (GRCm39) V89A probably benign Het
Slc40a1 C T 1: 45,950,457 (GRCm39) A332T probably damaging Het
Slc44a3 A T 3: 121,291,496 (GRCm39) Y373* probably null Het
Slf2 T C 19: 44,937,440 (GRCm39) V722A probably benign Het
Spanxn4 A G 12: 62,734,624 (GRCm39) noncoding transcript Het
Stag3 T A 5: 138,296,901 (GRCm39) probably null Het
Tanc1 T C 2: 59,628,038 (GRCm39) I612T possibly damaging Het
Thbs2 T A 17: 14,906,043 (GRCm39) M286L probably benign Het
Top1 T A 2: 160,545,515 (GRCm39) N294K probably benign Het
Tpr T G 1: 150,302,644 (GRCm39) L1381V probably damaging Het
Ttc41 A G 10: 86,611,857 (GRCm39) Y1075C probably damaging Het
Ubox5 C T 2: 130,439,376 (GRCm39) G418D probably benign Het
Vmn1r67 T C 7: 10,180,907 (GRCm39) V57A possibly damaging Het
Zbtb5 T C 4: 44,993,500 (GRCm39) H628R probably damaging Het
Zfp810 T C 9: 22,190,216 (GRCm39) I231V probably benign Het
Other mutations in Trpm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Trpm8 APN 1 88,307,549 (GRCm39) missense possibly damaging 0.82
IGL01387:Trpm8 APN 1 88,271,009 (GRCm39) missense probably damaging 1.00
IGL01933:Trpm8 APN 1 88,254,127 (GRCm39) missense probably damaging 0.98
IGL02075:Trpm8 APN 1 88,253,210 (GRCm39) missense probably damaging 1.00
IGL02184:Trpm8 APN 1 88,258,416 (GRCm39) critical splice acceptor site probably null
IGL02342:Trpm8 APN 1 88,255,972 (GRCm39) missense possibly damaging 0.58
IGL02416:Trpm8 APN 1 88,288,438 (GRCm39) missense probably damaging 1.00
IGL02696:Trpm8 APN 1 88,275,773 (GRCm39) missense probably damaging 1.00
IGL02807:Trpm8 APN 1 88,275,830 (GRCm39) missense probably damaging 1.00
R0078:Trpm8 UTSW 1 88,255,870 (GRCm39) splice site probably benign
R1183:Trpm8 UTSW 1 88,275,813 (GRCm39) missense probably damaging 1.00
R1713:Trpm8 UTSW 1 88,292,802 (GRCm39) missense probably damaging 1.00
R1724:Trpm8 UTSW 1 88,278,578 (GRCm39) missense possibly damaging 0.86
R1966:Trpm8 UTSW 1 88,260,470 (GRCm39) splice site probably null
R2089:Trpm8 UTSW 1 88,271,048 (GRCm39) missense probably damaging 0.99
R2091:Trpm8 UTSW 1 88,271,048 (GRCm39) missense probably damaging 0.99
R2091:Trpm8 UTSW 1 88,271,048 (GRCm39) missense probably damaging 0.99
R2384:Trpm8 UTSW 1 88,287,378 (GRCm39) missense probably benign 0.00
R2475:Trpm8 UTSW 1 88,282,171 (GRCm39) missense probably damaging 1.00
R3726:Trpm8 UTSW 1 88,255,918 (GRCm39) missense probably benign 0.00
R3745:Trpm8 UTSW 1 88,276,049 (GRCm39) missense probably benign 0.21
R4063:Trpm8 UTSW 1 88,289,727 (GRCm39) missense probably damaging 1.00
R4678:Trpm8 UTSW 1 88,264,851 (GRCm39) missense probably benign 0.07
R4681:Trpm8 UTSW 1 88,312,427 (GRCm39) missense possibly damaging 0.63
R5031:Trpm8 UTSW 1 88,275,910 (GRCm39) missense probably benign 0.00
R5620:Trpm8 UTSW 1 88,287,373 (GRCm39) critical splice acceptor site probably null
R5644:Trpm8 UTSW 1 88,287,461 (GRCm39) missense possibly damaging 0.54
R5734:Trpm8 UTSW 1 88,283,002 (GRCm39) missense probably benign 0.01
R5839:Trpm8 UTSW 1 88,253,228 (GRCm39) missense possibly damaging 0.57
R5844:Trpm8 UTSW 1 88,312,433 (GRCm39) makesense probably null
R5845:Trpm8 UTSW 1 88,255,902 (GRCm39) missense probably benign 0.00
R5926:Trpm8 UTSW 1 88,258,469 (GRCm39) missense probably damaging 0.99
R5940:Trpm8 UTSW 1 88,279,137 (GRCm39) nonsense probably null
R6031:Trpm8 UTSW 1 88,282,191 (GRCm39) missense possibly damaging 0.95
R6031:Trpm8 UTSW 1 88,282,191 (GRCm39) missense possibly damaging 0.95
R6088:Trpm8 UTSW 1 88,234,400 (GRCm39) start gained probably benign
R6283:Trpm8 UTSW 1 88,276,054 (GRCm39) missense probably benign 0.09
R6299:Trpm8 UTSW 1 88,282,201 (GRCm39) missense probably damaging 1.00
R6367:Trpm8 UTSW 1 88,287,405 (GRCm39) missense probably damaging 1.00
R6526:Trpm8 UTSW 1 88,289,720 (GRCm39) missense probably damaging 0.98
R6682:Trpm8 UTSW 1 88,254,224 (GRCm39) missense probably damaging 0.96
R6751:Trpm8 UTSW 1 88,312,428 (GRCm39) missense possibly damaging 0.63
R7057:Trpm8 UTSW 1 88,289,802 (GRCm39) missense probably null 0.99
R7489:Trpm8 UTSW 1 88,307,481 (GRCm39) missense possibly damaging 0.85
R7520:Trpm8 UTSW 1 88,271,043 (GRCm39) missense probably benign 0.00
R7597:Trpm8 UTSW 1 88,255,918 (GRCm39) missense probably damaging 0.97
R7774:Trpm8 UTSW 1 88,258,563 (GRCm39) missense probably damaging 0.99
R7839:Trpm8 UTSW 1 88,254,176 (GRCm39) missense possibly damaging 0.83
R7948:Trpm8 UTSW 1 88,302,091 (GRCm39) nonsense probably null
R8176:Trpm8 UTSW 1 88,292,837 (GRCm39) missense probably benign 0.06
R8222:Trpm8 UTSW 1 88,253,390 (GRCm39) splice site probably null
R8946:Trpm8 UTSW 1 88,276,061 (GRCm39) splice site probably benign
R9121:Trpm8 UTSW 1 88,312,423 (GRCm39) missense probably benign 0.17
R9290:Trpm8 UTSW 1 88,246,767 (GRCm39) missense probably damaging 1.00
R9564:Trpm8 UTSW 1 88,254,158 (GRCm39) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TTGTGGCACCATTCAGGATTGCCC -3'
(R):5'- CAAGATGCAGTGCAGAATGACCCC -3'

Sequencing Primer
(F):5'- ATTCAGGATTGCCCTCCCC -3'
(R):5'- TGCGTGGCTTCAAAGCAA -3'
Posted On 2014-04-24