Incidental Mutation 'R1608:Ddx31'
ID 176601
Institutional Source Beutler Lab
Gene Symbol Ddx31
Ensembl Gene ENSMUSG00000026806
Gene Name DEAD/H box helicase 31
Synonyms 5830444G11Rik, DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31
MMRRC Submission 039645-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.879) question?
Stock # R1608 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 28730418-28795583 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 28749078 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 291 (N291K)
Ref Sequence ENSEMBL: ENSMUSP00000109484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113853]
AlphaFold Q6NZQ2
Predicted Effect probably damaging
Transcript: ENSMUST00000113853
AA Change: N291K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109484
Gene: ENSMUSG00000026806
AA Change: N291K

DomainStartEndE-ValueType
DEXDc 123 332 2.28e-48 SMART
HELICc 408 487 4.02e-26 SMART
DUF4217 556 621 6.21e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152685
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The function of this member has not been determined. Alternative splicing of this gene generates multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 A G 9: 30,813,775 (GRCm39) S797P probably damaging Het
Akap9 T C 5: 4,011,783 (GRCm39) Y829H probably damaging Het
Anp32a A G 9: 62,279,375 (GRCm39) D74G probably damaging Het
B3gat1 T C 9: 26,663,112 (GRCm39) I13T probably damaging Het
Cbfa2t3 A T 8: 123,374,448 (GRCm39) V99D probably damaging Het
Celsr2 C T 3: 108,309,799 (GRCm39) C1600Y probably damaging Het
Dennd1a T G 2: 37,742,446 (GRCm39) M3L probably benign Het
Dnah12 C T 14: 26,488,147 (GRCm39) P1017L probably damaging Het
Dnajc6 A T 4: 101,456,364 (GRCm39) D86V probably damaging Het
Evx2 T G 2: 74,488,195 (GRCm39) K208N probably damaging Het
F13a1 A G 13: 37,052,785 (GRCm39) V718A probably damaging Het
Fcho2 T C 13: 98,862,706 (GRCm39) D757G probably benign Het
Fmnl2 A G 2: 52,995,549 (GRCm39) E424G probably damaging Het
Fryl C T 5: 73,232,094 (GRCm39) W424* probably null Het
Gata3 G T 2: 9,879,579 (GRCm39) Y97* probably null Het
Gm15446 T A 5: 110,090,323 (GRCm39) C192S probably damaging Het
Hdac10 A T 15: 89,009,521 (GRCm39) D470E probably benign Het
Ier2 A G 8: 85,389,055 (GRCm39) L109P probably benign Het
Iftap T C 2: 101,440,916 (GRCm39) E29G probably damaging Het
Kcnh2 T C 5: 24,527,217 (GRCm39) T559A probably benign Het
Khk C T 5: 31,087,938 (GRCm39) A204V probably damaging Het
Kndc1 T A 7: 139,507,321 (GRCm39) M1169K possibly damaging Het
Krtap31-1 A G 11: 99,798,919 (GRCm39) S41G probably benign Het
Nabp1 T C 1: 51,512,162 (GRCm39) probably null Het
Nphp3 A G 9: 103,913,039 (GRCm39) D939G probably benign Het
Or5e1 A T 7: 108,354,309 (GRCm39) N82I probably damaging Het
Plcg2 T C 8: 118,340,974 (GRCm39) I1089T possibly damaging Het
Ptk2 A T 15: 73,134,424 (GRCm39) D558E probably damaging Het
Serpinb6d A G 13: 33,853,112 (GRCm39) D168G probably benign Het
Shisa8 G A 15: 82,092,756 (GRCm39) P189L probably damaging Het
Shkbp1 A G 7: 27,054,204 (GRCm39) V89A probably benign Het
Slc40a1 C T 1: 45,950,457 (GRCm39) A332T probably damaging Het
Slc44a3 A T 3: 121,291,496 (GRCm39) Y373* probably null Het
Slf2 T C 19: 44,937,440 (GRCm39) V722A probably benign Het
Spanxn4 A G 12: 62,734,624 (GRCm39) noncoding transcript Het
Stag3 T A 5: 138,296,901 (GRCm39) probably null Het
Tanc1 T C 2: 59,628,038 (GRCm39) I612T possibly damaging Het
Thbs2 T A 17: 14,906,043 (GRCm39) M286L probably benign Het
Top1 T A 2: 160,545,515 (GRCm39) N294K probably benign Het
Tpr T G 1: 150,302,644 (GRCm39) L1381V probably damaging Het
Trpm8 T G 1: 88,254,154 (GRCm39) S126A probably benign Het
Ttc41 A G 10: 86,611,857 (GRCm39) Y1075C probably damaging Het
Ubox5 C T 2: 130,439,376 (GRCm39) G418D probably benign Het
Vmn1r67 T C 7: 10,180,907 (GRCm39) V57A possibly damaging Het
Zbtb5 T C 4: 44,993,500 (GRCm39) H628R probably damaging Het
Zfp810 T C 9: 22,190,216 (GRCm39) I231V probably benign Het
Other mutations in Ddx31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01664:Ddx31 APN 2 28,765,847 (GRCm39) splice site probably benign
IGL01918:Ddx31 APN 2 28,764,176 (GRCm39) missense probably damaging 1.00
IGL02174:Ddx31 APN 2 28,749,041 (GRCm39) missense probably damaging 1.00
IGL02560:Ddx31 APN 2 28,765,838 (GRCm39) missense probably damaging 1.00
IGL02938:Ddx31 APN 2 28,749,035 (GRCm39) missense possibly damaging 0.49
R0241:Ddx31 UTSW 2 28,738,303 (GRCm39) missense probably damaging 1.00
R0241:Ddx31 UTSW 2 28,738,303 (GRCm39) missense probably damaging 1.00
R0440:Ddx31 UTSW 2 28,747,144 (GRCm39) missense probably damaging 1.00
R0701:Ddx31 UTSW 2 28,748,789 (GRCm39) missense probably null 1.00
R0729:Ddx31 UTSW 2 28,764,186 (GRCm39) missense probably damaging 1.00
R1227:Ddx31 UTSW 2 28,747,187 (GRCm39) missense probably damaging 1.00
R1532:Ddx31 UTSW 2 28,771,171 (GRCm39) missense probably benign 0.00
R1646:Ddx31 UTSW 2 28,782,532 (GRCm39) missense probably benign
R1674:Ddx31 UTSW 2 28,748,828 (GRCm39) missense probably damaging 1.00
R1834:Ddx31 UTSW 2 28,782,465 (GRCm39) missense probably damaging 1.00
R1884:Ddx31 UTSW 2 28,749,002 (GRCm39) missense probably damaging 0.97
R4133:Ddx31 UTSW 2 28,748,864 (GRCm39) missense probably damaging 1.00
R4911:Ddx31 UTSW 2 28,794,696 (GRCm39) missense probably benign 0.00
R4972:Ddx31 UTSW 2 28,750,782 (GRCm39) missense probably damaging 1.00
R5240:Ddx31 UTSW 2 28,736,042 (GRCm39) missense probably benign 0.03
R5358:Ddx31 UTSW 2 28,753,782 (GRCm39) missense probably damaging 0.98
R5450:Ddx31 UTSW 2 28,776,981 (GRCm39) missense probably damaging 0.97
R5945:Ddx31 UTSW 2 28,749,902 (GRCm39) missense probably damaging 1.00
R5956:Ddx31 UTSW 2 28,764,185 (GRCm39) missense probably damaging 1.00
R6235:Ddx31 UTSW 2 28,734,854 (GRCm39) missense probably benign 0.00
R6245:Ddx31 UTSW 2 28,734,994 (GRCm39) missense probably benign 0.00
R6463:Ddx31 UTSW 2 28,737,525 (GRCm39) critical splice donor site probably null
R6647:Ddx31 UTSW 2 28,765,750 (GRCm39) missense probably damaging 1.00
R6783:Ddx31 UTSW 2 28,764,188 (GRCm39) missense probably benign 0.26
R6917:Ddx31 UTSW 2 28,782,421 (GRCm39) missense probably damaging 1.00
R7135:Ddx31 UTSW 2 28,738,318 (GRCm39) missense probably benign
R7819:Ddx31 UTSW 2 28,782,463 (GRCm39) missense probably damaging 1.00
R8812:Ddx31 UTSW 2 28,730,816 (GRCm39) unclassified probably benign
R9122:Ddx31 UTSW 2 28,748,753 (GRCm39) missense probably damaging 1.00
R9326:Ddx31 UTSW 2 28,749,008 (GRCm39) missense probably damaging 1.00
R9571:Ddx31 UTSW 2 28,750,034 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGGGGACTGTTTGTCCTGCCATC -3'
(R):5'- GGCACGGAACTCGTGTTACCTTAC -3'

Sequencing Primer
(F):5'- ATCTCCAGGACAGACCTGTG -3'
(R):5'- GTCAGAACGTGGACTCTTAATG -3'
Posted On 2014-04-24