Incidental Mutation 'R1608:Tanc1'
ID 176604
Institutional Source Beutler Lab
Gene Symbol Tanc1
Ensembl Gene ENSMUSG00000035168
Gene Name tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Synonyms 1200003E16Rik
MMRRC Submission 039645-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1608 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 59442386-59676493 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 59628038 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 612 (I612T)
Ref Sequence ENSEMBL: ENSMUSP00000123345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037526] [ENSMUST00000112568] [ENSMUST00000139863]
AlphaFold Q0VGY8
Predicted Effect possibly damaging
Transcript: ENSMUST00000037526
AA Change: I612T

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000036003
Gene: ENSMUSG00000035168
AA Change: I612T

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 171 191 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 439 451 N/A INTRINSIC
low complexity region 455 475 N/A INTRINSIC
ANK 893 925 1.06e3 SMART
ANK 929 960 2.43e3 SMART
ANK 964 993 1.12e-3 SMART
Blast:ANK 997 1028 7e-12 BLAST
ANK 1037 1066 1.78e3 SMART
ANK 1075 1104 2.34e-1 SMART
ANK 1108 1137 3.71e-4 SMART
ANK 1141 1170 1.51e-4 SMART
ANK 1174 1203 4.89e-4 SMART
ANK 1207 1236 3.01e-4 SMART
ANK 1240 1269 1.99e2 SMART
TPR 1286 1319 7.49e1 SMART
TPR 1333 1366 2.35e-1 SMART
TPR 1367 1400 6.29e-2 SMART
low complexity region 1416 1432 N/A INTRINSIC
low complexity region 1454 1483 N/A INTRINSIC
low complexity region 1656 1686 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000056900
Predicted Effect probably benign
Transcript: ENSMUST00000112568
AA Change: I605T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000108187
Gene: ENSMUSG00000035168
AA Change: I605T

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 171 191 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 432 444 N/A INTRINSIC
low complexity region 448 468 N/A INTRINSIC
ANK 886 918 1.06e3 SMART
ANK 922 953 2.43e3 SMART
ANK 957 986 1.12e-3 SMART
Blast:ANK 990 1021 7e-12 BLAST
ANK 1030 1059 1.78e3 SMART
ANK 1068 1097 2.34e-1 SMART
ANK 1101 1130 3.71e-4 SMART
ANK 1134 1163 1.51e-4 SMART
ANK 1167 1196 4.89e-4 SMART
ANK 1200 1229 3.01e-4 SMART
ANK 1233 1262 1.99e2 SMART
TPR 1279 1312 7.49e1 SMART
TPR 1326 1359 2.35e-1 SMART
TPR 1360 1393 6.29e-2 SMART
low complexity region 1409 1425 N/A INTRINSIC
low complexity region 1447 1476 N/A INTRINSIC
low complexity region 1649 1679 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000139863
AA Change: I612T

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123345
Gene: ENSMUSG00000035168
AA Change: I612T

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 171 191 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 439 451 N/A INTRINSIC
low complexity region 455 475 N/A INTRINSIC
ANK 893 925 1.06e3 SMART
ANK 929 960 2.43e3 SMART
ANK 964 993 1.12e-3 SMART
Blast:ANK 997 1028 7e-12 BLAST
ANK 1037 1066 1.78e3 SMART
ANK 1075 1104 2.34e-1 SMART
ANK 1108 1137 3.71e-4 SMART
ANK 1141 1170 1.51e-4 SMART
ANK 1174 1203 4.89e-4 SMART
ANK 1207 1236 3.01e-4 SMART
ANK 1240 1269 1.99e2 SMART
TPR 1286 1319 7.49e1 SMART
TPR 1333 1366 2.35e-1 SMART
TPR 1367 1400 6.29e-2 SMART
low complexity region 1416 1432 N/A INTRINSIC
low complexity region 1454 1483 N/A INTRINSIC
low complexity region 1656 1686 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap vector exhibit decreased spine density in the CA3 region and impaired spatial memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 A G 9: 30,813,775 (GRCm39) S797P probably damaging Het
Akap9 T C 5: 4,011,783 (GRCm39) Y829H probably damaging Het
Anp32a A G 9: 62,279,375 (GRCm39) D74G probably damaging Het
B3gat1 T C 9: 26,663,112 (GRCm39) I13T probably damaging Het
Cbfa2t3 A T 8: 123,374,448 (GRCm39) V99D probably damaging Het
Celsr2 C T 3: 108,309,799 (GRCm39) C1600Y probably damaging Het
Ddx31 T A 2: 28,749,078 (GRCm39) N291K probably damaging Het
Dennd1a T G 2: 37,742,446 (GRCm39) M3L probably benign Het
Dnah12 C T 14: 26,488,147 (GRCm39) P1017L probably damaging Het
Dnajc6 A T 4: 101,456,364 (GRCm39) D86V probably damaging Het
Evx2 T G 2: 74,488,195 (GRCm39) K208N probably damaging Het
F13a1 A G 13: 37,052,785 (GRCm39) V718A probably damaging Het
Fcho2 T C 13: 98,862,706 (GRCm39) D757G probably benign Het
Fmnl2 A G 2: 52,995,549 (GRCm39) E424G probably damaging Het
Fryl C T 5: 73,232,094 (GRCm39) W424* probably null Het
Gata3 G T 2: 9,879,579 (GRCm39) Y97* probably null Het
Gm15446 T A 5: 110,090,323 (GRCm39) C192S probably damaging Het
Hdac10 A T 15: 89,009,521 (GRCm39) D470E probably benign Het
Ier2 A G 8: 85,389,055 (GRCm39) L109P probably benign Het
Iftap T C 2: 101,440,916 (GRCm39) E29G probably damaging Het
Kcnh2 T C 5: 24,527,217 (GRCm39) T559A probably benign Het
Khk C T 5: 31,087,938 (GRCm39) A204V probably damaging Het
Kndc1 T A 7: 139,507,321 (GRCm39) M1169K possibly damaging Het
Krtap31-1 A G 11: 99,798,919 (GRCm39) S41G probably benign Het
Nabp1 T C 1: 51,512,162 (GRCm39) probably null Het
Nphp3 A G 9: 103,913,039 (GRCm39) D939G probably benign Het
Or5e1 A T 7: 108,354,309 (GRCm39) N82I probably damaging Het
Plcg2 T C 8: 118,340,974 (GRCm39) I1089T possibly damaging Het
Ptk2 A T 15: 73,134,424 (GRCm39) D558E probably damaging Het
Serpinb6d A G 13: 33,853,112 (GRCm39) D168G probably benign Het
Shisa8 G A 15: 82,092,756 (GRCm39) P189L probably damaging Het
Shkbp1 A G 7: 27,054,204 (GRCm39) V89A probably benign Het
Slc40a1 C T 1: 45,950,457 (GRCm39) A332T probably damaging Het
Slc44a3 A T 3: 121,291,496 (GRCm39) Y373* probably null Het
Slf2 T C 19: 44,937,440 (GRCm39) V722A probably benign Het
Spanxn4 A G 12: 62,734,624 (GRCm39) noncoding transcript Het
Stag3 T A 5: 138,296,901 (GRCm39) probably null Het
Thbs2 T A 17: 14,906,043 (GRCm39) M286L probably benign Het
Top1 T A 2: 160,545,515 (GRCm39) N294K probably benign Het
Tpr T G 1: 150,302,644 (GRCm39) L1381V probably damaging Het
Trpm8 T G 1: 88,254,154 (GRCm39) S126A probably benign Het
Ttc41 A G 10: 86,611,857 (GRCm39) Y1075C probably damaging Het
Ubox5 C T 2: 130,439,376 (GRCm39) G418D probably benign Het
Vmn1r67 T C 7: 10,180,907 (GRCm39) V57A possibly damaging Het
Zbtb5 T C 4: 44,993,500 (GRCm39) H628R probably damaging Het
Zfp810 T C 9: 22,190,216 (GRCm39) I231V probably benign Het
Other mutations in Tanc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Tanc1 APN 2 59,621,185 (GRCm39) missense possibly damaging 0.84
IGL00484:Tanc1 APN 2 59,623,520 (GRCm39) missense probably benign 0.00
IGL00688:Tanc1 APN 2 59,645,735 (GRCm39) missense probably damaging 1.00
IGL00765:Tanc1 APN 2 59,636,645 (GRCm39) missense probably benign 0.15
IGL01576:Tanc1 APN 2 59,628,079 (GRCm39) missense probably damaging 1.00
IGL01590:Tanc1 APN 2 59,615,817 (GRCm39) missense probably benign
IGL02016:Tanc1 APN 2 59,673,934 (GRCm39) missense probably benign 0.00
IGL02373:Tanc1 APN 2 59,626,372 (GRCm39) critical splice donor site probably null
IGL02539:Tanc1 APN 2 59,663,602 (GRCm39) missense probably damaging 1.00
IGL02540:Tanc1 APN 2 59,663,602 (GRCm39) missense probably damaging 1.00
IGL02541:Tanc1 APN 2 59,663,602 (GRCm39) missense probably damaging 1.00
IGL02543:Tanc1 APN 2 59,663,602 (GRCm39) missense probably damaging 1.00
IGL02559:Tanc1 APN 2 59,554,998 (GRCm39) splice site probably benign
IGL02626:Tanc1 APN 2 59,630,216 (GRCm39) missense probably damaging 1.00
IGL02669:Tanc1 APN 2 59,630,330 (GRCm39) missense probably damaging 1.00
IGL02902:Tanc1 APN 2 59,623,431 (GRCm39) splice site probably benign
Oreja UTSW 2 59,622,148 (GRCm39) synonymous silent
R0178:Tanc1 UTSW 2 59,665,791 (GRCm39) nonsense probably null
R0347:Tanc1 UTSW 2 59,673,335 (GRCm39) missense probably benign
R0570:Tanc1 UTSW 2 59,626,382 (GRCm39) splice site probably benign
R0660:Tanc1 UTSW 2 59,674,228 (GRCm39) nonsense probably null
R0664:Tanc1 UTSW 2 59,674,228 (GRCm39) nonsense probably null
R0898:Tanc1 UTSW 2 59,621,132 (GRCm39) missense probably damaging 1.00
R1333:Tanc1 UTSW 2 59,673,835 (GRCm39) missense probably benign
R1575:Tanc1 UTSW 2 59,621,995 (GRCm39) missense probably damaging 1.00
R1616:Tanc1 UTSW 2 59,615,731 (GRCm39) missense probably damaging 1.00
R1703:Tanc1 UTSW 2 59,673,365 (GRCm39) missense probably benign 0.02
R1727:Tanc1 UTSW 2 59,621,153 (GRCm39) missense probably damaging 1.00
R1809:Tanc1 UTSW 2 59,630,441 (GRCm39) missense probably damaging 1.00
R1812:Tanc1 UTSW 2 59,622,023 (GRCm39) missense probably damaging 1.00
R1925:Tanc1 UTSW 2 59,555,095 (GRCm39) missense possibly damaging 0.48
R1951:Tanc1 UTSW 2 59,622,156 (GRCm39) missense possibly damaging 0.92
R2174:Tanc1 UTSW 2 59,674,177 (GRCm39) missense possibly damaging 0.72
R2228:Tanc1 UTSW 2 59,555,068 (GRCm39) missense probably benign 0.04
R2267:Tanc1 UTSW 2 59,667,563 (GRCm39) critical splice donor site probably null
R4191:Tanc1 UTSW 2 59,669,357 (GRCm39) missense probably damaging 1.00
R4476:Tanc1 UTSW 2 59,672,340 (GRCm39) splice site probably null
R4632:Tanc1 UTSW 2 59,626,179 (GRCm39) missense probably damaging 1.00
R4825:Tanc1 UTSW 2 59,529,766 (GRCm39) missense probably damaging 1.00
R4982:Tanc1 UTSW 2 59,630,287 (GRCm39) missense probably damaging 1.00
R5338:Tanc1 UTSW 2 59,626,178 (GRCm39) missense probably damaging 1.00
R5657:Tanc1 UTSW 2 59,665,051 (GRCm39) splice site probably null
R5672:Tanc1 UTSW 2 59,602,697 (GRCm39) missense possibly damaging 0.81
R5703:Tanc1 UTSW 2 59,626,341 (GRCm39) missense probably damaging 0.98
R5707:Tanc1 UTSW 2 59,588,874 (GRCm39) missense probably benign
R5778:Tanc1 UTSW 2 59,529,691 (GRCm39) critical splice acceptor site probably null
R5795:Tanc1 UTSW 2 59,637,926 (GRCm39) missense possibly damaging 0.62
R5831:Tanc1 UTSW 2 59,615,685 (GRCm39) missense possibly damaging 0.89
R5849:Tanc1 UTSW 2 59,630,248 (GRCm39) missense probably benign 0.00
R5912:Tanc1 UTSW 2 59,622,030 (GRCm39) missense possibly damaging 0.92
R5944:Tanc1 UTSW 2 59,667,564 (GRCm39) critical splice donor site probably null
R6057:Tanc1 UTSW 2 59,647,837 (GRCm39) missense possibly damaging 0.46
R6142:Tanc1 UTSW 2 59,663,566 (GRCm39) nonsense probably null
R6179:Tanc1 UTSW 2 59,673,320 (GRCm39) missense probably benign 0.42
R6185:Tanc1 UTSW 2 59,621,929 (GRCm39) splice site probably null
R6192:Tanc1 UTSW 2 59,669,305 (GRCm39) splice site probably null
R6196:Tanc1 UTSW 2 59,674,366 (GRCm39) missense possibly damaging 0.94
R6197:Tanc1 UTSW 2 59,674,366 (GRCm39) missense possibly damaging 0.94
R6230:Tanc1 UTSW 2 59,672,375 (GRCm39) missense probably damaging 1.00
R6275:Tanc1 UTSW 2 59,673,854 (GRCm39) missense probably benign 0.22
R6415:Tanc1 UTSW 2 59,667,458 (GRCm39) missense probably benign 0.02
R6480:Tanc1 UTSW 2 59,637,986 (GRCm39) missense probably damaging 1.00
R6578:Tanc1 UTSW 2 59,626,298 (GRCm39) missense probably damaging 1.00
R6786:Tanc1 UTSW 2 59,622,150 (GRCm39) missense probably benign 0.00
R7006:Tanc1 UTSW 2 59,626,188 (GRCm39) missense probably damaging 1.00
R7133:Tanc1 UTSW 2 59,627,953 (GRCm39) missense probably benign 0.16
R7381:Tanc1 UTSW 2 59,615,670 (GRCm39) missense probably damaging 1.00
R7422:Tanc1 UTSW 2 59,636,688 (GRCm39) missense probably benign 0.02
R8392:Tanc1 UTSW 2 59,636,651 (GRCm39) missense probably damaging 0.99
R8692:Tanc1 UTSW 2 59,673,989 (GRCm39) missense probably benign 0.01
R8730:Tanc1 UTSW 2 59,601,590 (GRCm39) missense probably benign 0.00
R8731:Tanc1 UTSW 2 59,673,596 (GRCm39) missense probably benign 0.01
R8813:Tanc1 UTSW 2 59,630,265 (GRCm39) missense probably damaging 1.00
R8815:Tanc1 UTSW 2 59,621,185 (GRCm39) missense possibly damaging 0.84
R8933:Tanc1 UTSW 2 59,615,800 (GRCm39) missense possibly damaging 0.92
R9015:Tanc1 UTSW 2 59,622,224 (GRCm39) missense probably benign
R9042:Tanc1 UTSW 2 59,673,766 (GRCm39) missense probably benign 0.00
R9154:Tanc1 UTSW 2 59,630,132 (GRCm39) missense probably damaging 1.00
R9269:Tanc1 UTSW 2 59,630,432 (GRCm39) missense probably damaging 1.00
R9283:Tanc1 UTSW 2 59,630,174 (GRCm39) missense probably damaging 0.99
R9380:Tanc1 UTSW 2 59,665,796 (GRCm39) missense probably damaging 1.00
R9422:Tanc1 UTSW 2 59,637,933 (GRCm39) missense probably benign 0.08
R9428:Tanc1 UTSW 2 59,601,548 (GRCm39) missense probably damaging 1.00
R9694:Tanc1 UTSW 2 59,626,196 (GRCm39) missense probably damaging 1.00
RF028:Tanc1 UTSW 2 59,673,613 (GRCm39) small deletion probably benign
RF049:Tanc1 UTSW 2 59,673,613 (GRCm39) small deletion probably benign
X0063:Tanc1 UTSW 2 59,674,324 (GRCm39) nonsense probably null
X0064:Tanc1 UTSW 2 59,674,456 (GRCm39) missense probably damaging 1.00
Z1176:Tanc1 UTSW 2 59,602,873 (GRCm39) missense possibly damaging 0.93
Z1177:Tanc1 UTSW 2 59,622,174 (GRCm39) missense probably damaging 1.00
Z1177:Tanc1 UTSW 2 59,621,231 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAGGCTACCCAGGTTTATGAAGG -3'
(R):5'- GGACAGCTCAATGCTGCTAGGATG -3'

Sequencing Primer
(F):5'- CTACCCAGGTTTATGAAGGACTAAC -3'
(R):5'- TACGGGACTCTCTGGACTAC -3'
Posted On 2014-04-24