Incidental Mutation 'R1608:Ubox5'
ID 176608
Institutional Source Beutler Lab
Gene Symbol Ubox5
Ensembl Gene ENSMUSG00000027300
Gene Name U box domain containing 5
Synonyms 1500010O06Rik, C330018L13Rik, UIP5
MMRRC Submission 039645-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1608 (G1)
Quality Score 187
Status Not validated
Chromosome 2
Chromosomal Location 130590002-130630038 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 130597456 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 418 (G418D)
Ref Sequence ENSEMBL: ENSMUSP00000028761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028761] [ENSMUST00000140581]
AlphaFold Q925F4
Predicted Effect probably benign
Transcript: ENSMUST00000028761
AA Change: G418D

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000028761
Gene: ENSMUSG00000027300
AA Change: G418D

DomainStartEndE-ValueType
Ubox 262 331 4.47e-15 SMART
low complexity region 371 395 N/A INTRINSIC
RING 481 525 3.14e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140581
SMART Domains Protein: ENSMUSP00000114878
Gene: ENSMUSG00000027300

DomainStartEndE-ValueType
Pfam:FAST_1 474 546 2.6e-27 PFAM
Pfam:FAST_2 553 598 2.1e-10 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a U-box domain containing protein. The encoded protein interacts with E2 enzymes and may play a role in the ubiquitination pathway. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 A G 9: 30,902,479 S797P probably damaging Het
Akap9 T C 5: 3,961,783 Y829H probably damaging Het
Anp32a A G 9: 62,372,093 D74G probably damaging Het
B230118H07Rik T C 2: 101,610,571 E29G probably damaging Het
B3gat1 T C 9: 26,751,816 I13T probably damaging Het
Cbfa2t3 A T 8: 122,647,709 V99D probably damaging Het
Celsr2 C T 3: 108,402,483 C1600Y probably damaging Het
Ddx31 T A 2: 28,859,066 N291K probably damaging Het
Dennd1a T G 2: 37,852,434 M3L probably benign Het
Dnah12 C T 14: 26,766,190 P1017L probably damaging Het
Dnajc6 A T 4: 101,599,167 D86V probably damaging Het
Evx2 T G 2: 74,657,851 K208N probably damaging Het
F13a1 A G 13: 36,868,811 V718A probably damaging Het
Fcho2 T C 13: 98,726,198 D757G probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Fryl C T 5: 73,074,751 W424* probably null Het
Gata3 G T 2: 9,874,768 Y97* probably null Het
Gm15446 T A 5: 109,942,457 C192S probably damaging Het
Hdac10 A T 15: 89,125,318 D470E probably benign Het
Ier2 A G 8: 84,662,426 L109P probably benign Het
Kcnh2 T C 5: 24,322,219 T559A probably benign Het
Khk C T 5: 30,930,594 A204V probably damaging Het
Kndc1 T A 7: 139,927,408 M1169K possibly damaging Het
Krtap31-1 A G 11: 99,908,093 S41G probably benign Het
Nabp1 T C 1: 51,473,003 probably null Het
Nphp3 A G 9: 104,035,840 D939G probably benign Het
Olfr513 A T 7: 108,755,102 N82I probably damaging Het
Plcg2 T C 8: 117,614,235 I1089T possibly damaging Het
Ptk2 A T 15: 73,262,575 D558E probably damaging Het
Serpinb6d A G 13: 33,669,129 D168G probably benign Het
Shisa8 G A 15: 82,208,555 P189L probably damaging Het
Shkbp1 A G 7: 27,354,779 V89A probably benign Het
Slc40a1 C T 1: 45,911,297 A332T probably damaging Het
Slc44a3 A T 3: 121,497,847 Y373* probably null Het
Slf2 T C 19: 44,949,001 V722A probably benign Het
Spanxn4 A G 12: 62,687,838 noncoding transcript Het
Stag3 T A 5: 138,298,639 probably null Het
Tanc1 T C 2: 59,797,694 I612T possibly damaging Het
Thbs2 T A 17: 14,685,781 M286L probably benign Het
Top1 T A 2: 160,703,595 N294K probably benign Het
Tpr T G 1: 150,426,893 L1381V probably damaging Het
Trpm8 T G 1: 88,326,432 S126A probably benign Het
Ttc41 A G 10: 86,775,993 Y1075C probably damaging Het
Vmn1r67 T C 7: 10,446,980 V57A possibly damaging Het
Zbtb5 T C 4: 44,993,500 H628R probably damaging Het
Zfp810 T C 9: 22,278,920 I231V probably benign Het
Other mutations in Ubox5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Ubox5 APN 2 130599888 missense probably damaging 0.99
IGL01947:Ubox5 APN 2 130600659 missense possibly damaging 0.95
IGL01978:Ubox5 APN 2 130600452 missense probably benign 0.00
IGL02252:Ubox5 APN 2 130599787 missense probably damaging 1.00
IGL02994:Ubox5 APN 2 130600317 missense probably benign 0.13
IGL03150:Ubox5 APN 2 130600140 missense probably benign 0.44
PIT4403001:Ubox5 UTSW 2 130600677 missense probably damaging 0.99
R0792:Ubox5 UTSW 2 130600710 missense probably damaging 0.99
R1344:Ubox5 UTSW 2 130600290 missense probably damaging 1.00
R1418:Ubox5 UTSW 2 130600290 missense probably damaging 1.00
R1436:Ubox5 UTSW 2 130597293 unclassified probably benign
R1650:Ubox5 UTSW 2 130600425 missense probably benign 0.03
R1772:Ubox5 UTSW 2 130591874 missense probably benign 0.24
R2495:Ubox5 UTSW 2 130599521 nonsense probably null
R4767:Ubox5 UTSW 2 130591894 missense probably damaging 1.00
R5107:Ubox5 UTSW 2 130599768 missense probably damaging 1.00
R8271:Ubox5 UTSW 2 130599709 missense probably benign
R8290:Ubox5 UTSW 2 130600413 missense probably damaging 1.00
R9330:Ubox5 UTSW 2 130600245 missense probably benign 0.00
R9599:Ubox5 UTSW 2 130599915 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAGACTAGGTTCAGCATCCCGC -3'
(R):5'- ATGGCTCTGTCCTGCACAACAC -3'

Sequencing Primer
(F):5'- CACAGGCAGATGTTAGAGCCC -3'
(R):5'- ACAACACTTTGTCTAGGGAGCTG -3'
Posted On 2014-04-24