Mutagenetix > Incidental Mutation

Incidental Mutation 'R1608:Top1'

176609

Institutional Source

Beutler Lab

Gene Symbol

Top1

Ensembl Gene

ENSMUSG00000070544

Gene Name

topoisomerase (DNA) I

Synonyms

D130064I21Rik, Top-1

MMRRC Submission

039645-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1608 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

160645888-160722764 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 160703595 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 294 (N294K)

Ref Sequence

ENSEMBL: ENSMUSP00000105094 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109468]

AlphaFold

Q04750

Predicted Effect

probably benign
Transcript: ENSMUST00000109468
AA Change: N294K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000105094
Gene: ENSMUSG00000070544
AA Change: N294K

Domain	Start	End	E-Value	Type
low complexity region	20	95	N/A	INTRINSIC
low complexity region	150	211	N/A	INTRINSIC
Blast:TOPEUc	245	321	9e-19	BLAST
low complexity region	323	339	N/A	INTRINSIC
TOPEUc	362	739	4.43e-280	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164510

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 89.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This enzyme catalyzes the transient breaking and rejoining of a single strand of DNA which allows the strands to pass through one another, thus altering the topology of DNA. This gene is localized to chromosome 20 and has pseudogenes which reside on chromosomes 1 and 22. [provided by RefSeq, Jul 2008]
PHENOTYPE: A homozygous mutation resulted in early embryonic lethality at the 4 to 16 cell stage of development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts15	A	G	9: 30,902,479	S797P	probably damaging	Het
Akap9	T	C	5: 3,961,783	Y829H	probably damaging	Het
Anp32a	A	G	9: 62,372,093	D74G	probably damaging	Het
B230118H07Rik	T	C	2: 101,610,571	E29G	probably damaging	Het
B3gat1	T	C	9: 26,751,816	I13T	probably damaging	Het
Cbfa2t3	A	T	8: 122,647,709	V99D	probably damaging	Het
Celsr2	C	T	3: 108,402,483	C1600Y	probably damaging	Het
Ddx31	T	A	2: 28,859,066	N291K	probably damaging	Het
Dennd1a	T	G	2: 37,852,434	M3L	probably benign	Het
Dnah12	C	T	14: 26,766,190	P1017L	probably damaging	Het
Dnajc6	A	T	4: 101,599,167	D86V	probably damaging	Het
Evx2	T	G	2: 74,657,851	K208N	probably damaging	Het
F13a1	A	G	13: 36,868,811	V718A	probably damaging	Het
Fcho2	T	C	13: 98,726,198	D757G	probably benign	Het
Fmnl2	A	G	2: 53,105,537	E424G	probably damaging	Het
Fryl	C	T	5: 73,074,751	W424*	probably null	Het
Gata3	G	T	2: 9,874,768	Y97*	probably null	Het
Gm15446	T	A	5: 109,942,457	C192S	probably damaging	Het
Hdac10	A	T	15: 89,125,318	D470E	probably benign	Het
Ier2	A	G	8: 84,662,426	L109P	probably benign	Het
Kcnh2	T	C	5: 24,322,219	T559A	probably benign	Het
Khk	C	T	5: 30,930,594	A204V	probably damaging	Het
Kndc1	T	A	7: 139,927,408	M1169K	possibly damaging	Het
Krtap31-1	A	G	11: 99,908,093	S41G	probably benign	Het
Nabp1	T	C	1: 51,473,003		probably null	Het
Nphp3	A	G	9: 104,035,840	D939G	probably benign	Het
Olfr513	A	T	7: 108,755,102	N82I	probably damaging	Het
Plcg2	T	C	8: 117,614,235	I1089T	possibly damaging	Het
Ptk2	A	T	15: 73,262,575	D558E	probably damaging	Het
Serpinb6d	A	G	13: 33,669,129	D168G	probably benign	Het
Shisa8	G	A	15: 82,208,555	P189L	probably damaging	Het
Shkbp1	A	G	7: 27,354,779	V89A	probably benign	Het
Slc40a1	C	T	1: 45,911,297	A332T	probably damaging	Het
Slc44a3	A	T	3: 121,497,847	Y373*	probably null	Het
Slf2	T	C	19: 44,949,001	V722A	probably benign	Het
Spanxn4	A	G	12: 62,687,838		noncoding transcript	Het
Stag3	T	A	5: 138,298,639		probably null	Het
Tanc1	T	C	2: 59,797,694	I612T	possibly damaging	Het
Thbs2	T	A	17: 14,685,781	M286L	probably benign	Het
Tpr	T	G	1: 150,426,893	L1381V	probably damaging	Het
Trpm8	T	G	1: 88,326,432	S126A	probably benign	Het
Ttc41	A	G	10: 86,775,993	Y1075C	probably damaging	Het
Ubox5	C	T	2: 130,597,456	G418D	probably benign	Het
Vmn1r67	T	C	7: 10,446,980	V57A	possibly damaging	Het
Zbtb5	T	C	4: 44,993,500	H628R	probably damaging	Het
Zfp810	T	C	9: 22,278,920	I231V	probably benign	Het

Other mutations in Top1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02168:Top1	APN	2	160704973	splice site	probably null
IGL03083:Top1	APN	2	160703578	missense	probably damaging	0.97
IGL03242:Top1	APN	2	160715733	missense	probably damaging	1.00
IGL03369:Top1	APN	2	160693727	missense	unknown
Mainspring	UTSW	2	160714238	missense	probably damaging	0.98
taut	UTSW	2	160721001	missense	probably damaging	0.99
unwind	UTSW	2	160704819	missense	probably damaging	1.00
R0022:Top1	UTSW	2	160702799	missense	possibly damaging	0.62
R0449:Top1	UTSW	2	160712708	nonsense	probably null
R0501:Top1	UTSW	2	160714159	missense	probably damaging	1.00
R0564:Top1	UTSW	2	160714265	missense	probably damaging	0.98
R0946:Top1	UTSW	2	160712668	nonsense	probably null
R0972:Top1	UTSW	2	160721025	missense	probably damaging	1.00
R0976:Top1	UTSW	2	160717423	missense	possibly damaging	0.86
R1534:Top1	UTSW	2	160714232	missense	probably damaging	1.00
R1655:Top1	UTSW	2	160703696	critical splice donor site	probably null
R1818:Top1	UTSW	2	160715723	missense	probably damaging	1.00
R1937:Top1	UTSW	2	160670122	missense	unknown
R2055:Top1	UTSW	2	160702828	splice site	probably benign
R2104:Top1	UTSW	2	160704819	missense	probably damaging	1.00
R3705:Top1	UTSW	2	160702824	critical splice donor site	probably null
R3769:Top1	UTSW	2	160721522	missense	probably damaging	1.00
R3770:Top1	UTSW	2	160721522	missense	probably damaging	1.00
R3801:Top1	UTSW	2	160702768	missense	probably damaging	1.00
R3804:Top1	UTSW	2	160702768	missense	probably damaging	1.00
R3928:Top1	UTSW	2	160687749	splice site	probably benign
R4598:Top1	UTSW	2	160720965	missense	possibly damaging	0.89
R4651:Top1	UTSW	2	160712717	missense	probably damaging	1.00
R4652:Top1	UTSW	2	160712717	missense	probably damaging	1.00
R4742:Top1	UTSW	2	160703570	critical splice acceptor site	probably null
R5523:Top1	UTSW	2	160702775	nonsense	probably null
R6292:Top1	UTSW	2	160698141	missense	probably benign	0.19
R6724:Top1	UTSW	2	160712696	missense	probably damaging	1.00
R7354:Top1	UTSW	2	160704958	missense	probably damaging	1.00
R7461:Top1	UTSW	2	160712842	splice site	probably null
R7843:Top1	UTSW	2	160714256	missense	possibly damaging	0.90
R7855:Top1	UTSW	2	160714088	missense	probably damaging	1.00
R8100:Top1	UTSW	2	160698235	nonsense	probably null
R8302:Top1	UTSW	2	160703576	missense	probably damaging	1.00
R8377:Top1	UTSW	2	160646089	start gained	probably benign
R8380:Top1	UTSW	2	160717395	missense	probably benign	0.00
R8381:Top1	UTSW	2	160703674	missense	probably null	0.77
R8392:Top1	UTSW	2	160717454	nonsense	probably null
R8713:Top1	UTSW	2	160717440	missense	probably damaging	0.98
R8773:Top1	UTSW	2	160714238	missense	probably damaging	0.98
R8844:Top1	UTSW	2	160721549	missense	probably damaging	1.00
R8949:Top1	UTSW	2	160705262	missense	possibly damaging	0.77
R8992:Top1	UTSW	2	160721001	missense	probably damaging	0.99
R9133:Top1	UTSW	2	160703671	nonsense	probably null
R9799:Top1	UTSW	2	160721486	missense	probably damaging	1.00
X0027:Top1	UTSW	2	160721518	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTGATGCCTTTACACAGGGTCAGTC -3'
(R):5'- AGATAGCTGCCAGTTAGCACAACAC -3'

Sequencing Primer
(F):5'- TTCACCATCCAAGGGCATTC -3'
(R):5'- GAATTCACTGTTGTGTCACAAGAAG -3'

Posted On

2014-04-24