Incidental Mutation 'R1608:Top1'
ID176609
Institutional Source Beutler Lab
Gene Symbol Top1
Ensembl Gene ENSMUSG00000070544
Gene Nametopoisomerase (DNA) I
SynonymsD130064I21Rik, Top-1
MMRRC Submission 039645-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1608 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location160645888-160722764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 160703595 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 294 (N294K)
Ref Sequence ENSEMBL: ENSMUSP00000105094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109468]
Predicted Effect probably benign
Transcript: ENSMUST00000109468
AA Change: N294K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000105094
Gene: ENSMUSG00000070544
AA Change: N294K

DomainStartEndE-ValueType
low complexity region 20 95 N/A INTRINSIC
low complexity region 150 211 N/A INTRINSIC
Blast:TOPEUc 245 321 9e-19 BLAST
low complexity region 323 339 N/A INTRINSIC
TOPEUc 362 739 4.43e-280 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164510
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This enzyme catalyzes the transient breaking and rejoining of a single strand of DNA which allows the strands to pass through one another, thus altering the topology of DNA. This gene is localized to chromosome 20 and has pseudogenes which reside on chromosomes 1 and 22. [provided by RefSeq, Jul 2008]
PHENOTYPE: A homozygous mutation resulted in early embryonic lethality at the 4 to 16 cell stage of development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 A G 9: 30,902,479 S797P probably damaging Het
Akap9 T C 5: 3,961,783 Y829H probably damaging Het
Anp32a A G 9: 62,372,093 D74G probably damaging Het
B230118H07Rik T C 2: 101,610,571 E29G probably damaging Het
B3gat1 T C 9: 26,751,816 I13T probably damaging Het
Cbfa2t3 A T 8: 122,647,709 V99D probably damaging Het
Celsr2 C T 3: 108,402,483 C1600Y probably damaging Het
Ddx31 T A 2: 28,859,066 N291K probably damaging Het
Dennd1a T G 2: 37,852,434 M3L probably benign Het
Dnah12 C T 14: 26,766,190 P1017L probably damaging Het
Dnajc6 A T 4: 101,599,167 D86V probably damaging Het
Evx2 T G 2: 74,657,851 K208N probably damaging Het
F13a1 A G 13: 36,868,811 V718A probably damaging Het
Fcho2 T C 13: 98,726,198 D757G probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Fryl C T 5: 73,074,751 W424* probably null Het
Gata3 G T 2: 9,874,768 Y97* probably null Het
Gm15446 T A 5: 109,942,457 C192S probably damaging Het
Hdac10 A T 15: 89,125,318 D470E probably benign Het
Ier2 A G 8: 84,662,426 L109P probably benign Het
Kcnh2 T C 5: 24,322,219 T559A probably benign Het
Khk C T 5: 30,930,594 A204V probably damaging Het
Kndc1 T A 7: 139,927,408 M1169K possibly damaging Het
Krtap31-1 A G 11: 99,908,093 S41G probably benign Het
Nabp1 T C 1: 51,473,003 probably null Het
Nphp3 A G 9: 104,035,840 D939G probably benign Het
Olfr513 A T 7: 108,755,102 N82I probably damaging Het
Plcg2 T C 8: 117,614,235 I1089T possibly damaging Het
Ptk2 A T 15: 73,262,575 D558E probably damaging Het
Serpinb6d A G 13: 33,669,129 D168G probably benign Het
Shisa8 G A 15: 82,208,555 P189L probably damaging Het
Shkbp1 A G 7: 27,354,779 V89A probably benign Het
Slc40a1 C T 1: 45,911,297 A332T probably damaging Het
Slc44a3 A T 3: 121,497,847 Y373* probably null Het
Slf2 T C 19: 44,949,001 V722A probably benign Het
Spanxn4 A G 12: 62,687,838 noncoding transcript Het
Stag3 T A 5: 138,298,639 probably null Het
Tanc1 T C 2: 59,797,694 I612T possibly damaging Het
Thbs2 T A 17: 14,685,781 M286L probably benign Het
Tpr T G 1: 150,426,893 L1381V probably damaging Het
Trpm8 T G 1: 88,326,432 S126A probably benign Het
Ttc41 A G 10: 86,775,993 Y1075C probably damaging Het
Ubox5 C T 2: 130,597,456 G418D probably benign Het
Vmn1r67 T C 7: 10,446,980 V57A possibly damaging Het
Zbtb5 T C 4: 44,993,500 H628R probably damaging Het
Zfp810 T C 9: 22,278,920 I231V probably benign Het
Other mutations in Top1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02168:Top1 APN 2 160704973 splice site probably null
IGL03083:Top1 APN 2 160703578 missense probably damaging 0.97
IGL03242:Top1 APN 2 160715733 missense probably damaging 1.00
IGL03369:Top1 APN 2 160693727 missense unknown
R0022:Top1 UTSW 2 160702799 missense possibly damaging 0.62
R0449:Top1 UTSW 2 160712708 nonsense probably null
R0501:Top1 UTSW 2 160714159 missense probably damaging 1.00
R0564:Top1 UTSW 2 160714265 missense probably damaging 0.98
R0946:Top1 UTSW 2 160712668 nonsense probably null
R0972:Top1 UTSW 2 160721025 missense probably damaging 1.00
R0976:Top1 UTSW 2 160717423 missense possibly damaging 0.86
R1534:Top1 UTSW 2 160714232 missense probably damaging 1.00
R1655:Top1 UTSW 2 160703696 critical splice donor site probably null
R1818:Top1 UTSW 2 160715723 missense probably damaging 1.00
R1937:Top1 UTSW 2 160670122 missense unknown
R2055:Top1 UTSW 2 160702828 splice site probably benign
R2104:Top1 UTSW 2 160704819 missense probably damaging 1.00
R3705:Top1 UTSW 2 160702824 critical splice donor site probably null
R3769:Top1 UTSW 2 160721522 missense probably damaging 1.00
R3770:Top1 UTSW 2 160721522 missense probably damaging 1.00
R3801:Top1 UTSW 2 160702768 missense probably damaging 1.00
R3804:Top1 UTSW 2 160702768 missense probably damaging 1.00
R3928:Top1 UTSW 2 160687749 splice site probably benign
R4598:Top1 UTSW 2 160720965 missense possibly damaging 0.89
R4651:Top1 UTSW 2 160712717 missense probably damaging 1.00
R4652:Top1 UTSW 2 160712717 missense probably damaging 1.00
R4742:Top1 UTSW 2 160703570 critical splice acceptor site probably null
R5523:Top1 UTSW 2 160702775 nonsense probably null
R6292:Top1 UTSW 2 160698141 missense probably benign 0.19
R6724:Top1 UTSW 2 160712696 missense probably damaging 1.00
R7354:Top1 UTSW 2 160704958 missense probably damaging 1.00
R7461:Top1 UTSW 2 160712842 splice site probably null
R7843:Top1 UTSW 2 160714256 missense possibly damaging 0.90
R7855:Top1 UTSW 2 160714088 missense probably damaging 1.00
R8100:Top1 UTSW 2 160698235 nonsense probably null
R8302:Top1 UTSW 2 160703576 missense probably damaging 1.00
R8377:Top1 UTSW 2 160646089 start gained probably benign
R8380:Top1 UTSW 2 160717395 missense probably benign 0.00
R8381:Top1 UTSW 2 160703674 missense probably null 0.77
R8392:Top1 UTSW 2 160717454 nonsense probably null
X0027:Top1 UTSW 2 160721518 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGATGCCTTTACACAGGGTCAGTC -3'
(R):5'- AGATAGCTGCCAGTTAGCACAACAC -3'

Sequencing Primer
(F):5'- TTCACCATCCAAGGGCATTC -3'
(R):5'- GAATTCACTGTTGTGTCACAAGAAG -3'
Posted On2014-04-24