Incidental Mutation 'R1608:Slc44a3'
ID176611
Institutional Source Beutler Lab
Gene Symbol Slc44a3
Ensembl Gene ENSMUSG00000039865
Gene Namesolute carrier family 44, member 3
Synonyms
MMRRC Submission 039645-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1608 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location121459528-121532404 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 121497847 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 373 (Y373*)
Ref Sequence ENSEMBL: ENSMUSP00000040210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039197]
AlphaFold Q921V7
Predicted Effect probably null
Transcript: ENSMUST00000039197
AA Change: Y373*
SMART Domains Protein: ENSMUSP00000040210
Gene: ENSMUSG00000039865
AA Change: Y373*

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 217 239 N/A INTRINSIC
transmembrane domain 244 266 N/A INTRINSIC
Pfam:Choline_transpo 291 607 2.3e-80 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 A G 9: 30,902,479 S797P probably damaging Het
Akap9 T C 5: 3,961,783 Y829H probably damaging Het
Anp32a A G 9: 62,372,093 D74G probably damaging Het
B230118H07Rik T C 2: 101,610,571 E29G probably damaging Het
B3gat1 T C 9: 26,751,816 I13T probably damaging Het
Cbfa2t3 A T 8: 122,647,709 V99D probably damaging Het
Celsr2 C T 3: 108,402,483 C1600Y probably damaging Het
Ddx31 T A 2: 28,859,066 N291K probably damaging Het
Dennd1a T G 2: 37,852,434 M3L probably benign Het
Dnah12 C T 14: 26,766,190 P1017L probably damaging Het
Dnajc6 A T 4: 101,599,167 D86V probably damaging Het
Evx2 T G 2: 74,657,851 K208N probably damaging Het
F13a1 A G 13: 36,868,811 V718A probably damaging Het
Fcho2 T C 13: 98,726,198 D757G probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Fryl C T 5: 73,074,751 W424* probably null Het
Gata3 G T 2: 9,874,768 Y97* probably null Het
Gm15446 T A 5: 109,942,457 C192S probably damaging Het
Hdac10 A T 15: 89,125,318 D470E probably benign Het
Ier2 A G 8: 84,662,426 L109P probably benign Het
Kcnh2 T C 5: 24,322,219 T559A probably benign Het
Khk C T 5: 30,930,594 A204V probably damaging Het
Kndc1 T A 7: 139,927,408 M1169K possibly damaging Het
Krtap31-1 A G 11: 99,908,093 S41G probably benign Het
Nabp1 T C 1: 51,473,003 probably null Het
Nphp3 A G 9: 104,035,840 D939G probably benign Het
Olfr513 A T 7: 108,755,102 N82I probably damaging Het
Plcg2 T C 8: 117,614,235 I1089T possibly damaging Het
Ptk2 A T 15: 73,262,575 D558E probably damaging Het
Serpinb6d A G 13: 33,669,129 D168G probably benign Het
Shisa8 G A 15: 82,208,555 P189L probably damaging Het
Shkbp1 A G 7: 27,354,779 V89A probably benign Het
Slc40a1 C T 1: 45,911,297 A332T probably damaging Het
Slf2 T C 19: 44,949,001 V722A probably benign Het
Spanxn4 A G 12: 62,687,838 noncoding transcript Het
Stag3 T A 5: 138,298,639 probably null Het
Tanc1 T C 2: 59,797,694 I612T possibly damaging Het
Thbs2 T A 17: 14,685,781 M286L probably benign Het
Top1 T A 2: 160,703,595 N294K probably benign Het
Tpr T G 1: 150,426,893 L1381V probably damaging Het
Trpm8 T G 1: 88,326,432 S126A probably benign Het
Ttc41 A G 10: 86,775,993 Y1075C probably damaging Het
Ubox5 C T 2: 130,597,456 G418D probably benign Het
Vmn1r67 T C 7: 10,446,980 V57A possibly damaging Het
Zbtb5 T C 4: 44,993,500 H628R probably damaging Het
Zfp810 T C 9: 22,278,920 I231V probably benign Het
Other mutations in Slc44a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Slc44a3 APN 3 121527193 missense probably damaging 1.00
IGL01527:Slc44a3 APN 3 121527128 missense probably damaging 1.00
IGL02304:Slc44a3 APN 3 121527074 missense possibly damaging 0.48
IGL02419:Slc44a3 APN 3 121490257 missense probably benign 0.03
IGL02836:Slc44a3 APN 3 121531717 missense probably damaging 1.00
IGL02937:Slc44a3 APN 3 121510321 splice site probably benign
IGL03219:Slc44a3 APN 3 121463520 missense probably damaging 1.00
BB009:Slc44a3 UTSW 3 121512360 missense possibly damaging 0.86
BB019:Slc44a3 UTSW 3 121512360 missense possibly damaging 0.86
R0597:Slc44a3 UTSW 3 121460070 missense probably benign
R0668:Slc44a3 UTSW 3 121510203 missense probably damaging 0.96
R1355:Slc44a3 UTSW 3 121531671 missense probably damaging 1.00
R1617:Slc44a3 UTSW 3 121461265 missense probably benign 0.19
R1912:Slc44a3 UTSW 3 121532166 missense probably benign 0.00
R2027:Slc44a3 UTSW 3 121463410 splice site probably benign
R2087:Slc44a3 UTSW 3 121525670 missense probably damaging 0.99
R2199:Slc44a3 UTSW 3 121513744 missense probably benign 0.02
R4707:Slc44a3 UTSW 3 121527074 missense possibly damaging 0.48
R4736:Slc44a3 UTSW 3 121510206 missense probably damaging 0.97
R4784:Slc44a3 UTSW 3 121527074 missense possibly damaging 0.48
R4785:Slc44a3 UTSW 3 121527074 missense possibly damaging 0.48
R5302:Slc44a3 UTSW 3 121510313 missense probably damaging 1.00
R5835:Slc44a3 UTSW 3 121527200 missense probably benign 0.03
R6252:Slc44a3 UTSW 3 121513737 missense probably damaging 0.99
R6991:Slc44a3 UTSW 3 121532165 missense probably benign 0.01
R7197:Slc44a3 UTSW 3 121525762 missense probably benign 0.02
R7227:Slc44a3 UTSW 3 121510230 missense possibly damaging 0.93
R7272:Slc44a3 UTSW 3 121461115 missense probably damaging 0.99
R7932:Slc44a3 UTSW 3 121512360 missense possibly damaging 0.86
R8104:Slc44a3 UTSW 3 121497872 missense probably benign 0.01
R8529:Slc44a3 UTSW 3 121525685 missense probably benign 0.36
R8679:Slc44a3 UTSW 3 121490269 missense probably damaging 1.00
R8856:Slc44a3 UTSW 3 121513807 missense probably damaging 1.00
R9053:Slc44a3 UTSW 3 121527190 missense probably damaging 1.00
R9121:Slc44a3 UTSW 3 121461137 missense probably benign 0.00
Z1176:Slc44a3 UTSW 3 121532251 start gained probably benign
Z1177:Slc44a3 UTSW 3 121497750 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GGGGTTTAAGGGAGACTATTTCCGC -3'
(R):5'- GGCACCCATTTTCATGCCTTCAAAG -3'

Sequencing Primer
(F):5'- atccacctgcctctgcc -3'
(R):5'- ACTGTCAATAGCGTTGGCAC -3'
Posted On2014-04-24