Incidental Mutation 'R1608:Zbtb5'
ID176612
Institutional Source Beutler Lab
Gene Symbol Zbtb5
Ensembl Gene ENSMUSG00000049657
Gene Namezinc finger and BTB domain containing 5
Synonyms
MMRRC Submission 039645-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1608 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location44991242-45012412 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44993500 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 628 (H628R)
Ref Sequence ENSEMBL: ENSMUSP00000136507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045078] [ENSMUST00000055028] [ENSMUST00000107817] [ENSMUST00000131991] [ENSMUST00000151148] [ENSMUST00000180217]
Predicted Effect probably benign
Transcript: ENSMUST00000045078
SMART Domains Protein: ENSMUSP00000047218
Gene: ENSMUSG00000035637

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 9 327 1.4e-28 PFAM
Pfam:2-Hacid_dh_C 116 295 1.3e-59 PFAM
Pfam:NAD_binding_2 153 272 3.4e-8 PFAM
Pfam:F420_oxidored 155 244 3.2e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000055028
AA Change: H628R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059919
Gene: ENSMUSG00000049657
AA Change: H628R

DomainStartEndE-ValueType
BTB 24 123 1.06e-28 SMART
low complexity region 149 163 N/A INTRINSIC
low complexity region 345 361 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
low complexity region 444 459 N/A INTRINSIC
low complexity region 544 554 N/A INTRINSIC
ZnF_C2H2 606 628 1.16e-1 SMART
ZnF_C2H2 634 654 2.47e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107817
AA Change: H628R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103447
Gene: ENSMUSG00000049657
AA Change: H628R

DomainStartEndE-ValueType
BTB 24 123 1.06e-28 SMART
low complexity region 149 163 N/A INTRINSIC
low complexity region 345 361 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
low complexity region 444 459 N/A INTRINSIC
low complexity region 544 554 N/A INTRINSIC
ZnF_C2H2 606 628 1.16e-1 SMART
ZnF_C2H2 634 654 2.47e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131991
SMART Domains Protein: ENSMUSP00000122991
Gene: ENSMUSG00000049657

DomainStartEndE-ValueType
BTB 24 123 1.06e-28 SMART
low complexity region 149 163 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151148
SMART Domains Protein: ENSMUSP00000120254
Gene: ENSMUSG00000035637

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 10 207 4.5e-15 PFAM
Pfam:2-Hacid_dh_C 63 222 2.2e-51 PFAM
Pfam:NAD_binding_2 100 219 3.3e-9 PFAM
Pfam:F420_oxidored 102 191 5.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000180217
AA Change: H628R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136507
Gene: ENSMUSG00000049657
AA Change: H628R

DomainStartEndE-ValueType
BTB 24 123 1.06e-28 SMART
low complexity region 149 163 N/A INTRINSIC
low complexity region 345 361 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
low complexity region 444 459 N/A INTRINSIC
low complexity region 544 554 N/A INTRINSIC
ZnF_C2H2 606 628 1.16e-1 SMART
ZnF_C2H2 634 654 2.47e1 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 A G 9: 30,902,479 S797P probably damaging Het
Akap9 T C 5: 3,961,783 Y829H probably damaging Het
Anp32a A G 9: 62,372,093 D74G probably damaging Het
B230118H07Rik T C 2: 101,610,571 E29G probably damaging Het
B3gat1 T C 9: 26,751,816 I13T probably damaging Het
Cbfa2t3 A T 8: 122,647,709 V99D probably damaging Het
Celsr2 C T 3: 108,402,483 C1600Y probably damaging Het
Ddx31 T A 2: 28,859,066 N291K probably damaging Het
Dennd1a T G 2: 37,852,434 M3L probably benign Het
Dnah12 C T 14: 26,766,190 P1017L probably damaging Het
Dnajc6 A T 4: 101,599,167 D86V probably damaging Het
Evx2 T G 2: 74,657,851 K208N probably damaging Het
F13a1 A G 13: 36,868,811 V718A probably damaging Het
Fcho2 T C 13: 98,726,198 D757G probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Fryl C T 5: 73,074,751 W424* probably null Het
Gata3 G T 2: 9,874,768 Y97* probably null Het
Gm15446 T A 5: 109,942,457 C192S probably damaging Het
Hdac10 A T 15: 89,125,318 D470E probably benign Het
Ier2 A G 8: 84,662,426 L109P probably benign Het
Kcnh2 T C 5: 24,322,219 T559A probably benign Het
Khk C T 5: 30,930,594 A204V probably damaging Het
Kndc1 T A 7: 139,927,408 M1169K possibly damaging Het
Krtap31-1 A G 11: 99,908,093 S41G probably benign Het
Nabp1 T C 1: 51,473,003 probably null Het
Nphp3 A G 9: 104,035,840 D939G probably benign Het
Olfr513 A T 7: 108,755,102 N82I probably damaging Het
Plcg2 T C 8: 117,614,235 I1089T possibly damaging Het
Ptk2 A T 15: 73,262,575 D558E probably damaging Het
Serpinb6d A G 13: 33,669,129 D168G probably benign Het
Shisa8 G A 15: 82,208,555 P189L probably damaging Het
Shkbp1 A G 7: 27,354,779 V89A probably benign Het
Slc40a1 C T 1: 45,911,297 A332T probably damaging Het
Slc44a3 A T 3: 121,497,847 Y373* probably null Het
Slf2 T C 19: 44,949,001 V722A probably benign Het
Spanxn4 A G 12: 62,687,838 noncoding transcript Het
Stag3 T A 5: 138,298,639 probably null Het
Tanc1 T C 2: 59,797,694 I612T possibly damaging Het
Thbs2 T A 17: 14,685,781 M286L probably benign Het
Top1 T A 2: 160,703,595 N294K probably benign Het
Tpr T G 1: 150,426,893 L1381V probably damaging Het
Trpm8 T G 1: 88,326,432 S126A probably benign Het
Ttc41 A G 10: 86,775,993 Y1075C probably damaging Het
Ubox5 C T 2: 130,597,456 G418D probably benign Het
Vmn1r67 T C 7: 10,446,980 V57A possibly damaging Het
Zfp810 T C 9: 22,278,920 I231V probably benign Het
Other mutations in Zbtb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01995:Zbtb5 APN 4 44995294 missense probably damaging 1.00
IGL02516:Zbtb5 APN 4 44993798 missense probably damaging 0.96
IGL02525:Zbtb5 APN 4 44994731 missense probably benign
IGL03172:Zbtb5 APN 4 44994003 missense possibly damaging 0.76
IGL03205:Zbtb5 APN 4 44994949 missense probably damaging 0.96
madeleine UTSW 4 44994863 splice site probably null
R0681:Zbtb5 UTSW 4 44993787 missense probably damaging 1.00
R1426:Zbtb5 UTSW 4 44993968 missense possibly damaging 0.95
R1577:Zbtb5 UTSW 4 44995129 missense probably damaging 1.00
R1817:Zbtb5 UTSW 4 44993767 missense probably benign 0.20
R2919:Zbtb5 UTSW 4 44994790 missense probably damaging 1.00
R3722:Zbtb5 UTSW 4 44994863 splice site probably null
R4222:Zbtb5 UTSW 4 44993855 splice site probably null
R5217:Zbtb5 UTSW 4 44993990 missense probably benign
R5326:Zbtb5 UTSW 4 44995052 missense probably damaging 1.00
R5493:Zbtb5 UTSW 4 44993941 missense probably benign 0.04
R5542:Zbtb5 UTSW 4 44995052 missense probably damaging 1.00
R5912:Zbtb5 UTSW 4 44993750 missense probably benign 0.00
R6171:Zbtb5 UTSW 4 44994119 missense probably benign 0.00
R6337:Zbtb5 UTSW 4 44993459 missense probably damaging 1.00
R6566:Zbtb5 UTSW 4 44994508 missense probably damaging 1.00
R7481:Zbtb5 UTSW 4 44994905 missense probably benign 0.27
R7534:Zbtb5 UTSW 4 44995030 missense probably damaging 1.00
R7548:Zbtb5 UTSW 4 44994724 missense probably benign 0.18
R7557:Zbtb5 UTSW 4 44995196 missense probably damaging 1.00
R7584:Zbtb5 UTSW 4 44993678 missense probably benign
R7831:Zbtb5 UTSW 4 44995244 missense probably damaging 1.00
R8065:Zbtb5 UTSW 4 44994972 missense probably benign 0.25
R8067:Zbtb5 UTSW 4 44994972 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GCCTGCCTACAGCGGTTTTAGTTTC -3'
(R):5'- TTCAGCCAGTTCCCAGCTAATGATG -3'

Sequencing Primer
(F):5'- AGTTTCAGTGCAGACTGGC -3'
(R):5'- TTCCCAGCTAATGATGAACGG -3'
Posted On2014-04-24