Mutagenetix > Incidental Mutations

Incidental Mutation 'R1608:Dnajc6'

176613

Institutional Source

Beutler Lab

Gene Symbol

Dnajc6

Ensembl Gene

ENSMUSG00000028528

Gene Name

DnaJ heat shock protein family (Hsp40) member C6

Synonyms

auxilin, 2810027M23Rik

MMRRC Submission

039645-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.116) question?

Stock #

R1608 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101496648-101642799 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 101599167 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 86 (D86V)

Ref Sequence

ENSEMBL: ENSMUSP00000119542 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038207] [ENSMUST00000094953] [ENSMUST00000106929] [ENSMUST00000106930] [ENSMUST00000106933] [ENSMUST00000149047] [ENSMUST00000154120]

Predicted Effect

probably damaging
Transcript: ENSMUST00000038207
AA Change: D124V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000044251
Gene: ENSMUSG00000028528
AA Change: D124V

Domain	Start	End	E-Value	Type
SCOP:d1d5ra2	88	244	1e-20	SMART
PTEN_C2	251	390	5.95e-42	SMART
low complexity region	502	521	N/A	INTRINSIC
low complexity region	554	569	N/A	INTRINSIC
low complexity region	679	694	N/A	INTRINSIC
low complexity region	719	735	N/A	INTRINSIC
low complexity region	829	840	N/A	INTRINSIC
DnaJ	873	934	2e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000094953
AA Change: D86V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000092560
Gene: ENSMUSG00000028528
AA Change: D86V

Domain	Start	End	E-Value	Type
SCOP:d1d5ra2	50	206	2e-20	SMART
PTEN_C2	213	352	5.95e-42	SMART
low complexity region	464	483	N/A	INTRINSIC
low complexity region	516	531	N/A	INTRINSIC
low complexity region	641	656	N/A	INTRINSIC
low complexity region	681	697	N/A	INTRINSIC
low complexity region	791	802	N/A	INTRINSIC
DnaJ	835	896	2e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000106929
AA Change: D86V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102542
Gene: ENSMUSG00000028528
AA Change: D86V

Domain	Start	End	E-Value	Type
SCOP:d1d5ra2	50	206	2e-20	SMART
PTEN_C2	213	352	5.95e-42	SMART
low complexity region	464	483	N/A	INTRINSIC
low complexity region	516	531	N/A	INTRINSIC
low complexity region	641	656	N/A	INTRINSIC
low complexity region	681	697	N/A	INTRINSIC
low complexity region	791	802	N/A	INTRINSIC
DnaJ	835	896	2e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000106930
AA Change: D86V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102543
Gene: ENSMUSG00000028528
AA Change: D86V

Domain	Start	End	E-Value	Type
SCOP:d1d5ra2	50	206	2e-20	SMART
PTEN_C2	213	352	5.95e-42	SMART
low complexity region	464	483	N/A	INTRINSIC
low complexity region	516	531	N/A	INTRINSIC
low complexity region	641	656	N/A	INTRINSIC
low complexity region	681	697	N/A	INTRINSIC
low complexity region	791	802	N/A	INTRINSIC
DnaJ	835	896	2e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000106933
AA Change: D154V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000102546
Gene: ENSMUSG00000028528
AA Change: D154V

Domain	Start	End	E-Value	Type
low complexity region	30	44	N/A	INTRINSIC
SCOP:d1d5ra2	118	274	1e-20	SMART
PTEN_C2	281	420	5.95e-42	SMART
low complexity region	532	551	N/A	INTRINSIC
low complexity region	584	599	N/A	INTRINSIC
low complexity region	709	724	N/A	INTRINSIC
low complexity region	749	765	N/A	INTRINSIC
low complexity region	859	870	N/A	INTRINSIC
DnaJ	903	964	2e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146489

Predicted Effect

probably damaging
Transcript: ENSMUST00000149047
AA Change: D86V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119542
Gene: ENSMUSG00000028528
AA Change: D86V

Domain	Start	End	E-Value	Type
PDB:3N0A\|A	30	194	1e-118	PDB
SCOP:d1d5ra2	50	187	2e-17	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000154120
AA Change: D86V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000114840
Gene: ENSMUSG00000028528
AA Change: D86V

Domain	Start	End	E-Value	Type
PDB:3N0A\|A	30	116	4e-54	PDB
SCOP:d1d5ra2	50	101	1e-4	SMART

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 89.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNAJC6 belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus, a glycine/phenylalanine (G/F)-rich region, and a cysteine-rich domain containing 4 motifs resembling a zinc finger domain (Ohtsuka and Hata, 2000 [PubMed 11147971]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous and heterozygous for a knock-out allele exhibit postnatal lethality and decreased body weight with homozygotes exhibiting decreased synpatic vesicle recycling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts15	A	G	9: 30,902,479	S797P	probably damaging	Het
Akap9	T	C	5: 3,961,783	Y829H	probably damaging	Het
Anp32a	A	G	9: 62,372,093	D74G	probably damaging	Het
B230118H07Rik	T	C	2: 101,610,571	E29G	probably damaging	Het
B3gat1	T	C	9: 26,751,816	I13T	probably damaging	Het
Cbfa2t3	A	T	8: 122,647,709	V99D	probably damaging	Het
Celsr2	C	T	3: 108,402,483	C1600Y	probably damaging	Het
Ddx31	T	A	2: 28,859,066	N291K	probably damaging	Het
Dennd1a	T	G	2: 37,852,434	M3L	probably benign	Het
Dnah12	C	T	14: 26,766,190	P1017L	probably damaging	Het
Evx2	T	G	2: 74,657,851	K208N	probably damaging	Het
F13a1	A	G	13: 36,868,811	V718A	probably damaging	Het
Fcho2	T	C	13: 98,726,198	D757G	probably benign	Het
Fmnl2	A	G	2: 53,105,537	E424G	probably damaging	Het
Fryl	C	T	5: 73,074,751	W424*	probably null	Het
Gata3	G	T	2: 9,874,768	Y97*	probably null	Het
Gm15446	T	A	5: 109,942,457	C192S	probably damaging	Het
Hdac10	A	T	15: 89,125,318	D470E	probably benign	Het
Ier2	A	G	8: 84,662,426	L109P	probably benign	Het
Kcnh2	T	C	5: 24,322,219	T559A	probably benign	Het
Khk	C	T	5: 30,930,594	A204V	probably damaging	Het
Kndc1	T	A	7: 139,927,408	M1169K	possibly damaging	Het
Krtap31-1	A	G	11: 99,908,093	S41G	probably benign	Het
Nabp1	T	C	1: 51,473,003		probably null	Het
Nphp3	A	G	9: 104,035,840	D939G	probably benign	Het
Olfr513	A	T	7: 108,755,102	N82I	probably damaging	Het
Plcg2	T	C	8: 117,614,235	I1089T	possibly damaging	Het
Ptk2	A	T	15: 73,262,575	D558E	probably damaging	Het
Serpinb6d	A	G	13: 33,669,129	D168G	probably benign	Het
Shisa8	G	A	15: 82,208,555	P189L	probably damaging	Het
Shkbp1	A	G	7: 27,354,779	V89A	probably benign	Het
Slc40a1	C	T	1: 45,911,297	A332T	probably damaging	Het
Slc44a3	A	T	3: 121,497,847	Y373*	probably null	Het
Slf2	T	C	19: 44,949,001	V722A	probably benign	Het
Spanxn4	A	G	12: 62,687,838		noncoding transcript	Het
Stag3	T	A	5: 138,298,639		probably null	Het
Tanc1	T	C	2: 59,797,694	I612T	possibly damaging	Het
Thbs2	T	A	17: 14,685,781	M286L	probably benign	Het
Top1	T	A	2: 160,703,595	N294K	probably benign	Het
Tpr	T	G	1: 150,426,893	L1381V	probably damaging	Het
Trpm8	T	G	1: 88,326,432	S126A	probably benign	Het
Ttc41	A	G	10: 86,775,993	Y1075C	probably damaging	Het
Ubox5	C	T	2: 130,597,456	G418D	probably benign	Het
Vmn1r67	T	C	7: 10,446,980	V57A	possibly damaging	Het
Zbtb5	T	C	4: 44,993,500	H628R	probably damaging	Het
Zfp810	T	C	9: 22,278,920	I231V	probably benign	Het

Other mutations in Dnajc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Dnajc6	APN	4	101508089	intron	probably benign
IGL02336:Dnajc6	APN	4	101614286	splice site	probably null
IGL02551:Dnajc6	APN	4	101639353	missense	probably damaging	1.00
IGL02801:Dnajc6	APN	4	101597813	missense	probably benign	0.33
IGL02887:Dnajc6	APN	4	101639300	missense	probably damaging	1.00
IGL03107:Dnajc6	APN	4	101616860	missense	probably damaging	1.00
IGL03271:Dnajc6	APN	4	101508077	intron	probably benign
R0091:Dnajc6	UTSW	4	101616777	splice site	probably benign
R0384:Dnajc6	UTSW	4	101598956	missense	probably damaging	1.00
R0546:Dnajc6	UTSW	4	101635191	missense	probably damaging	0.99
R0689:Dnajc6	UTSW	4	101611253	missense	possibly damaging	0.91
R1239:Dnajc6	UTSW	4	101635116	missense	probably damaging	0.98
R1421:Dnajc6	UTSW	4	101611316	missense	probably damaging	0.97
R1424:Dnajc6	UTSW	4	101639347	missense	possibly damaging	0.92
R1563:Dnajc6	UTSW	4	101599137	missense	probably damaging	1.00
R1757:Dnajc6	UTSW	4	101597831	missense	probably damaging	1.00
R1856:Dnajc6	UTSW	4	101598988	missense	probably damaging	1.00
R2032:Dnajc6	UTSW	4	101614238	missense	probably benign	0.39
R2518:Dnajc6	UTSW	4	101612930	missense	probably damaging	0.99
R4028:Dnajc6	UTSW	4	101616857	missense	probably damaging	1.00
R4088:Dnajc6	UTSW	4	101639396	missense	probably damaging	1.00
R4601:Dnajc6	UTSW	4	101611264	missense	probably damaging	1.00
R4602:Dnajc6	UTSW	4	101611264	missense	probably damaging	1.00
R4610:Dnajc6	UTSW	4	101611264	missense	probably damaging	1.00
R4755:Dnajc6	UTSW	4	101550799	missense	probably damaging	1.00
R4878:Dnajc6	UTSW	4	101599034	intron	probably benign
R4938:Dnajc6	UTSW	4	101636813	missense	probably damaging	1.00
R5373:Dnajc6	UTSW	4	101615627	missense	probably damaging	0.99
R5391:Dnajc6	UTSW	4	101628158	critical splice donor site	probably null
R5435:Dnajc6	UTSW	4	101606610	missense	probably damaging	0.99
R5760:Dnajc6	UTSW	4	101618642	missense	probably benign	0.39
R6044:Dnajc6	UTSW	4	101616577	missense	probably benign	0.22
R6086:Dnajc6	UTSW	4	101597807	missense	probably benign	0.45
R6460:Dnajc6	UTSW	4	101615598	missense	probably damaging	1.00
R6495:Dnajc6	UTSW	4	101635065	nonsense	probably null
R6956:Dnajc6	UTSW	4	101614273	missense	probably damaging	0.97
R7072:Dnajc6	UTSW	4	101615615	missense	probably damaging	1.00
R7155:Dnajc6	UTSW	4	101612945	missense	probably damaging	1.00
R7192:Dnajc6	UTSW	4	101597803	missense	probably benign	0.02
R7226:Dnajc6	UTSW	4	101639372	missense	probably damaging	1.00
R7298:Dnajc6	UTSW	4	101606611	missense	probably benign	0.09
R7612:Dnajc6	UTSW	4	101597926	missense	probably benign	0.40
R7622:Dnajc6	UTSW	4	101640491	missense	probably damaging	1.00
R7652:Dnajc6	UTSW	4	101606677	missense	probably damaging	0.98
R7789:Dnajc6	UTSW	4	101618532	missense	possibly damaging	0.82
R8010:Dnajc6	UTSW	4	101618414	missense	probably benign	0.01
R8201:Dnajc6	UTSW	4	101618763	missense	probably benign	0.08
R8305:Dnajc6	UTSW	4	101623787	missense	probably damaging	1.00
R8912:Dnajc6	UTSW	4	101611316	missense	probably damaging	1.00
R9012:Dnajc6	UTSW	4	101612959	missense	probably damaging	1.00
R9052:Dnajc6	UTSW	4	101639420	missense	probably damaging	0.97
Z1088:Dnajc6	UTSW	4	101639329	missense	probably damaging	1.00
Z1177:Dnajc6	UTSW	4	101639428	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- GATTGCTCTAATGAGTGCCCTCTCC -3'
(R):5'- ACCTTCAACCAAGCCGATGGTG -3'

Sequencing Primer
(F):5'- GGGAGACCTAGACTTTACTTACGTC -3'
(R):5'- CCGATGGTGAAGCAACAGC -3'

Posted On

2014-04-24