Incidental Mutation 'R1608:Khk'
ID176616
Institutional Source Beutler Lab
Gene Symbol Khk
Ensembl Gene ENSMUSG00000029162
Gene Nameketohexokinase
Synonyms
MMRRC Submission 039645-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R1608 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location30921431-30931248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30930594 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 204 (A204V)
Ref Sequence ENSEMBL: ENSMUSP00000143850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031051] [ENSMUST00000031053] [ENSMUST00000201571] [ENSMUST00000201621] [ENSMUST00000202752]
Predicted Effect probably benign
Transcript: ENSMUST00000031051
SMART Domains Protein: ENSMUSP00000031051
Gene: ENSMUSG00000029161

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
low complexity region 28 44 N/A INTRINSIC
low complexity region 50 63 N/A INTRINSIC
SCOP:d2pvba_ 113 188 1e-4 SMART
Blast:EFh 120 148 1e-9 BLAST
Blast:EFh 164 189 4e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000031053
AA Change: A249V

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031053
Gene: ENSMUSG00000029162
AA Change: A249V

DomainStartEndE-ValueType
Pfam:PfkB 3 293 5.7e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117435
AA Change: A249V

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114064
Gene: ENSMUSG00000029162
AA Change: A249V

DomainStartEndE-ValueType
Pfam:PfkB 3 113 4.2e-15 PFAM
Pfam:PfkB 112 339 1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200978
Predicted Effect probably damaging
Transcript: ENSMUST00000201571
AA Change: A159V

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144226
Gene: ENSMUSG00000029162
AA Change: A159V

DomainStartEndE-ValueType
Pfam:PfkB 3 70 2.4e-5 PFAM
Pfam:PfkB 65 249 4.5e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201621
AA Change: A204V

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144050
Gene: ENSMUSG00000029162
AA Change: A204V

DomainStartEndE-ValueType
Pfam:PfkB 3 294 1.5e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202627
Predicted Effect probably damaging
Transcript: ENSMUST00000202752
AA Change: A204V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143850
Gene: ENSMUSG00000029162
AA Change: A204V

DomainStartEndE-ValueType
Pfam:PfkB 3 243 5.8e-18 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes ketohexokinase that catalyzes conversion of fructose to fructose-1-phosphate. The product of this gene is the first enzyme with a specialized pathway that catabolizes dietary fructose. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for alleles that do not produce isoform A or isoforms A and C exhibit normal fertility, development, blood chemistry, and tissue metabolite levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 A G 9: 30,902,479 S797P probably damaging Het
Akap9 T C 5: 3,961,783 Y829H probably damaging Het
Anp32a A G 9: 62,372,093 D74G probably damaging Het
B230118H07Rik T C 2: 101,610,571 E29G probably damaging Het
B3gat1 T C 9: 26,751,816 I13T probably damaging Het
Cbfa2t3 A T 8: 122,647,709 V99D probably damaging Het
Celsr2 C T 3: 108,402,483 C1600Y probably damaging Het
Ddx31 T A 2: 28,859,066 N291K probably damaging Het
Dennd1a T G 2: 37,852,434 M3L probably benign Het
Dnah12 C T 14: 26,766,190 P1017L probably damaging Het
Dnajc6 A T 4: 101,599,167 D86V probably damaging Het
Evx2 T G 2: 74,657,851 K208N probably damaging Het
F13a1 A G 13: 36,868,811 V718A probably damaging Het
Fcho2 T C 13: 98,726,198 D757G probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Fryl C T 5: 73,074,751 W424* probably null Het
Gata3 G T 2: 9,874,768 Y97* probably null Het
Gm15446 T A 5: 109,942,457 C192S probably damaging Het
Hdac10 A T 15: 89,125,318 D470E probably benign Het
Ier2 A G 8: 84,662,426 L109P probably benign Het
Kcnh2 T C 5: 24,322,219 T559A probably benign Het
Kndc1 T A 7: 139,927,408 M1169K possibly damaging Het
Krtap31-1 A G 11: 99,908,093 S41G probably benign Het
Nabp1 T C 1: 51,473,003 probably null Het
Nphp3 A G 9: 104,035,840 D939G probably benign Het
Olfr513 A T 7: 108,755,102 N82I probably damaging Het
Plcg2 T C 8: 117,614,235 I1089T possibly damaging Het
Ptk2 A T 15: 73,262,575 D558E probably damaging Het
Serpinb6d A G 13: 33,669,129 D168G probably benign Het
Shisa8 G A 15: 82,208,555 P189L probably damaging Het
Shkbp1 A G 7: 27,354,779 V89A probably benign Het
Slc40a1 C T 1: 45,911,297 A332T probably damaging Het
Slc44a3 A T 3: 121,497,847 Y373* probably null Het
Slf2 T C 19: 44,949,001 V722A probably benign Het
Spanxn4 A G 12: 62,687,838 noncoding transcript Het
Stag3 T A 5: 138,298,639 probably null Het
Tanc1 T C 2: 59,797,694 I612T possibly damaging Het
Thbs2 T A 17: 14,685,781 M286L probably benign Het
Top1 T A 2: 160,703,595 N294K probably benign Het
Tpr T G 1: 150,426,893 L1381V probably damaging Het
Trpm8 T G 1: 88,326,432 S126A probably benign Het
Ttc41 A G 10: 86,775,993 Y1075C probably damaging Het
Ubox5 C T 2: 130,597,456 G418D probably benign Het
Vmn1r67 T C 7: 10,446,980 V57A possibly damaging Het
Zbtb5 T C 4: 44,993,500 H628R probably damaging Het
Zfp810 T C 9: 22,278,920 I231V probably benign Het
Other mutations in Khk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Khk APN 5 30929675 critical splice donor site probably benign 0.00
IGL01551:Khk APN 5 30924845 missense probably benign 0.00
IGL02351:Khk APN 5 30928504 missense probably damaging 1.00
IGL02358:Khk APN 5 30928504 missense probably damaging 1.00
IGL03355:Khk APN 5 30929560 missense probably benign 0.44
R1916:Khk UTSW 5 30930618 missense probably damaging 1.00
R3816:Khk UTSW 5 30926716 missense probably damaging 1.00
R3855:Khk UTSW 5 30927057 missense probably benign 0.04
R5033:Khk UTSW 5 30929660 missense probably damaging 1.00
R5310:Khk UTSW 5 30927029 missense probably benign 0.08
R5843:Khk UTSW 5 30921931 missense possibly damaging 0.55
R5878:Khk UTSW 5 30930875 critical splice donor site probably null
R8719:Khk UTSW 5 30931030 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GCAAGAAGCCACACTAGGGACTTAC -3'
(R):5'- TCCAGCCCCAAGAGTGTCTACTAC -3'

Sequencing Primer
(F):5'- TACGTGACTGAGTTGGAGGAG -3'
(R):5'- CAAGAGTGTCTACTACTCGGGG -3'
Posted On2014-04-24