Incidental Mutation 'R1608:Plcg2'
Institutional Source Beutler Lab
Gene Symbol Plcg2
Ensembl Gene ENSMUSG00000034330
Gene Namephospholipase C, gamma 2
SynonymsPlcg-2, PLCgamma2
MMRRC Submission 039645-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1608 (G1)
Quality Score225
Status Not validated
Chromosomal Location117498291-117635142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117614235 bp
Amino Acid Change Isoleucine to Threonine at position 1089 (I1089T)
Ref Sequence ENSEMBL: ENSMUSP00000079991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081232]
PDB Structure
Crystal structure of the N-terminal SH2 domain of mouse phospholipase C-gamma 2 [X-RAY DIFFRACTION]
Solution structure of the SH3 domain from Phospholipase C, gamma 2 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081232
AA Change: I1089T

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079991
Gene: ENSMUSG00000034330
AA Change: I1089T

PH 21 133 1.87e-4 SMART
PLCXc 312 456 2.29e-96 SMART
low complexity region 461 476 N/A INTRINSIC
PDB:2K2J|A 478 516 6e-17 PDB
SH2 530 623 2.24e-30 SMART
SH2 644 726 1.16e-28 SMART
SH3 772 828 3.12e-18 SMART
PH 789 910 4.31e0 SMART
PLCYc 930 1044 1.18e-66 SMART
C2 1062 1167 1.41e-15 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane signaling enzyme that catalyzes the conversion of 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate to 1D-myo-inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) using calcium as a cofactor. IP3 and DAG are second messenger molecules important for transmitting signals from growth factor receptors and immune system receptors across the cell membrane. Mutations in this gene have been found in autoinflammation, antibody deficiency, and immune dysregulation syndrome and familial cold autoinflammatory syndrome 3. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for some null alleles show decreased B cell and impaired NK cell function. Other homozygous null alleles show aberrant separation of blood and lymphatic vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 A G 9: 30,902,479 S797P probably damaging Het
Akap9 T C 5: 3,961,783 Y829H probably damaging Het
Anp32a A G 9: 62,372,093 D74G probably damaging Het
B230118H07Rik T C 2: 101,610,571 E29G probably damaging Het
B3gat1 T C 9: 26,751,816 I13T probably damaging Het
Cbfa2t3 A T 8: 122,647,709 V99D probably damaging Het
Celsr2 C T 3: 108,402,483 C1600Y probably damaging Het
Ddx31 T A 2: 28,859,066 N291K probably damaging Het
Dennd1a T G 2: 37,852,434 M3L probably benign Het
Dnah12 C T 14: 26,766,190 P1017L probably damaging Het
Dnajc6 A T 4: 101,599,167 D86V probably damaging Het
Evx2 T G 2: 74,657,851 K208N probably damaging Het
F13a1 A G 13: 36,868,811 V718A probably damaging Het
Fcho2 T C 13: 98,726,198 D757G probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Fryl C T 5: 73,074,751 W424* probably null Het
Gata3 G T 2: 9,874,768 Y97* probably null Het
Gm15446 T A 5: 109,942,457 C192S probably damaging Het
Hdac10 A T 15: 89,125,318 D470E probably benign Het
Ier2 A G 8: 84,662,426 L109P probably benign Het
Kcnh2 T C 5: 24,322,219 T559A probably benign Het
Khk C T 5: 30,930,594 A204V probably damaging Het
Kndc1 T A 7: 139,927,408 M1169K possibly damaging Het
Krtap31-1 A G 11: 99,908,093 S41G probably benign Het
Nabp1 T C 1: 51,473,003 probably null Het
Nphp3 A G 9: 104,035,840 D939G probably benign Het
Olfr513 A T 7: 108,755,102 N82I probably damaging Het
Ptk2 A T 15: 73,262,575 D558E probably damaging Het
Serpinb6d A G 13: 33,669,129 D168G probably benign Het
Shisa8 G A 15: 82,208,555 P189L probably damaging Het
Shkbp1 A G 7: 27,354,779 V89A probably benign Het
Slc40a1 C T 1: 45,911,297 A332T probably damaging Het
Slc44a3 A T 3: 121,497,847 Y373* probably null Het
Slf2 T C 19: 44,949,001 V722A probably benign Het
Spanxn4 A G 12: 62,687,838 noncoding transcript Het
Stag3 T A 5: 138,298,639 probably null Het
Tanc1 T C 2: 59,797,694 I612T possibly damaging Het
Thbs2 T A 17: 14,685,781 M286L probably benign Het
Top1 T A 2: 160,703,595 N294K probably benign Het
Tpr T G 1: 150,426,893 L1381V probably damaging Het
Trpm8 T G 1: 88,326,432 S126A probably benign Het
Ttc41 A G 10: 86,775,993 Y1075C probably damaging Het
Ubox5 C T 2: 130,597,456 G418D probably benign Het
Vmn1r67 T C 7: 10,446,980 V57A possibly damaging Het
Zbtb5 T C 4: 44,993,500 H628R probably damaging Het
Zfp810 T C 9: 22,278,920 I231V probably benign Het
Other mutations in Plcg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Plcg2 APN 8 117556071 missense possibly damaging 0.89
IGL00911:Plcg2 APN 8 117586515 missense probably benign 0.17
IGL00952:Plcg2 APN 8 117607217 missense probably benign
IGL01115:Plcg2 APN 8 117557329 missense probably damaging 1.00
IGL01326:Plcg2 APN 8 117573999 splice site probably benign
IGL01357:Plcg2 APN 8 117614161 splice site probably benign
IGL01705:Plcg2 APN 8 117581662 missense probably damaging 1.00
IGL01755:Plcg2 APN 8 117621241 missense possibly damaging 0.48
IGL01828:Plcg2 APN 8 117590233 missense probably damaging 1.00
IGL02307:Plcg2 APN 8 117579896 critical splice donor site probably null
IGL02345:Plcg2 APN 8 117585180 missense probably damaging 0.99
IGL02448:Plcg2 APN 8 117607221 missense probably benign
IGL02587:Plcg2 APN 8 117558113 missense possibly damaging 0.80
IGL02646:Plcg2 APN 8 117603883 missense possibly damaging 0.88
IGL03409:Plcg2 APN 8 117583495 missense probably damaging 0.96
Poseidon UTSW 8 117615238 missense probably damaging 1.00
Poseidon2 UTSW 8 117577874 missense possibly damaging 0.80
queen UTSW 8 117581707 missense probably benign 0.00
Seahorse UTSW 8 117589835 splice site probably null
Teleost UTSW 8 117583549 missense probably damaging 1.00
Theseus UTSW 8 117596332 missense probably damaging 0.99
trident UTSW 8 117612978 missense probably benign 0.00
R0172:Plcg2 UTSW 8 117579782 missense probably benign 0.00
R0194:Plcg2 UTSW 8 117573397 splice site probably benign
R0410:Plcg2 UTSW 8 117615373 missense probably damaging 0.98
R0462:Plcg2 UTSW 8 117585305 missense probably benign 0.06
R0494:Plcg2 UTSW 8 117556104 missense probably damaging 1.00
R0522:Plcg2 UTSW 8 117614288 splice site probably null
R0612:Plcg2 UTSW 8 117573365 missense probably benign 0.01
R1239:Plcg2 UTSW 8 117556044 missense probably benign
R1367:Plcg2 UTSW 8 117615238 missense probably damaging 1.00
R1756:Plcg2 UTSW 8 117592708 missense probably benign 0.02
R2176:Plcg2 UTSW 8 117612994 missense probably damaging 1.00
R3500:Plcg2 UTSW 8 117612978 missense probably benign 0.00
R4043:Plcg2 UTSW 8 117612978 missense probably benign 0.00
R4654:Plcg2 UTSW 8 117504315 missense probably benign
R4883:Plcg2 UTSW 8 117607133 nonsense probably null
R4932:Plcg2 UTSW 8 117607083 missense probably benign 0.05
R5080:Plcg2 UTSW 8 117590003 missense probably benign 0.10
R5226:Plcg2 UTSW 8 117577874 missense possibly damaging 0.80
R5264:Plcg2 UTSW 8 117634793 missense possibly damaging 0.95
R5298:Plcg2 UTSW 8 117605249 missense probably benign
R5473:Plcg2 UTSW 8 117634401 missense probably benign
R5555:Plcg2 UTSW 8 117612995 nonsense probably null
R5557:Plcg2 UTSW 8 117586557 missense probably damaging 0.99
R5805:Plcg2 UTSW 8 117598495 critical splice donor site probably null
R5826:Plcg2 UTSW 8 117610844 missense probably benign 0.19
R5871:Plcg2 UTSW 8 117504217 missense probably damaging 1.00
R5894:Plcg2 UTSW 8 117504349 missense probably damaging 0.99
R6142:Plcg2 UTSW 8 117585271 missense probably benign
R6609:Plcg2 UTSW 8 117568170 missense probably benign 0.31
R6684:Plcg2 UTSW 8 117596332 missense probably damaging 0.99
R6710:Plcg2 UTSW 8 117557347 missense probably benign 0.05
R6931:Plcg2 UTSW 8 117557319 missense probably benign 0.24
R6946:Plcg2 UTSW 8 117504190 missense probably benign
R7036:Plcg2 UTSW 8 117596306 missense probably benign
R7070:Plcg2 UTSW 8 117596306 missense probably benign
R7072:Plcg2 UTSW 8 117589835 splice site probably null
R7214:Plcg2 UTSW 8 117583549 missense probably damaging 1.00
R7351:Plcg2 UTSW 8 117590310 missense possibly damaging 0.95
R7393:Plcg2 UTSW 8 117579825 missense possibly damaging 0.90
R7443:Plcg2 UTSW 8 117504289 missense probably benign 0.00
R7513:Plcg2 UTSW 8 117579853 missense probably damaging 0.99
R7609:Plcg2 UTSW 8 117558113 missense probably benign 0.01
R8134:Plcg2 UTSW 8 117557318 missense probably damaging 0.98
R8399:Plcg2 UTSW 8 117596362 missense probably damaging 1.00
RF008:Plcg2 UTSW 8 117573524 splice site probably null
X0027:Plcg2 UTSW 8 117555983 missense probably benign 0.03
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- aggaaacaggacaacccaag -3'
Posted On2014-04-24