Mutagenetix > Incidental Mutation

Incidental Mutation 'R1608:Plcg2'

176627

Institutional Source

Beutler Lab

Gene Symbol

Plcg2

Ensembl Gene

ENSMUSG00000034330

Gene Name

phospholipase C, gamma 2

Synonyms

Plcg-2, PLCgamma2

MMRRC Submission

039645-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1608 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

117498291-117635142 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 117614235 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1089 (I1089T)

Ref Sequence

ENSEMBL: ENSMUSP00000079991 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081232]

AlphaFold

Q8CIH5

PDB Structure

Crystal structure of the N-terminal SH2 domain of mouse phospholipase C-gamma 2 [X-RAY DIFFRACTION]
Solution structure of the SH3 domain from Phospholipase C, gamma 2 [SOLUTION NMR]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081232
AA Change: I1089T

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000079991
Gene: ENSMUSG00000034330
AA Change: I1089T

Domain	Start	End	E-Value	Type
PH	21	133	1.87e-4	SMART
PLCXc	312	456	2.29e-96	SMART
low complexity region	461	476	N/A	INTRINSIC
PDB:2K2J\|A	478	516	6e-17	PDB
SH2	530	623	2.24e-30	SMART
SH2	644	726	1.16e-28	SMART
SH3	772	828	3.12e-18	SMART
PH	789	910	4.31e0	SMART
PLCYc	930	1044	1.18e-66	SMART
C2	1062	1167	1.41e-15	SMART

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 89.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane signaling enzyme that catalyzes the conversion of 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate to 1D-myo-inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) using calcium as a cofactor. IP3 and DAG are second messenger molecules important for transmitting signals from growth factor receptors and immune system receptors across the cell membrane. Mutations in this gene have been found in autoinflammation, antibody deficiency, and immune dysregulation syndrome and familial cold autoinflammatory syndrome 3. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for some null alleles show decreased B cell and impaired NK cell function. Other homozygous null alleles show aberrant separation of blood and lymphatic vessels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts15	A	G	9: 30,902,479	S797P	probably damaging	Het
Akap9	T	C	5: 3,961,783	Y829H	probably damaging	Het
Anp32a	A	G	9: 62,372,093	D74G	probably damaging	Het
B230118H07Rik	T	C	2: 101,610,571	E29G	probably damaging	Het
B3gat1	T	C	9: 26,751,816	I13T	probably damaging	Het
Cbfa2t3	A	T	8: 122,647,709	V99D	probably damaging	Het
Celsr2	C	T	3: 108,402,483	C1600Y	probably damaging	Het
Ddx31	T	A	2: 28,859,066	N291K	probably damaging	Het
Dennd1a	T	G	2: 37,852,434	M3L	probably benign	Het
Dnah12	C	T	14: 26,766,190	P1017L	probably damaging	Het
Dnajc6	A	T	4: 101,599,167	D86V	probably damaging	Het
Evx2	T	G	2: 74,657,851	K208N	probably damaging	Het
F13a1	A	G	13: 36,868,811	V718A	probably damaging	Het
Fcho2	T	C	13: 98,726,198	D757G	probably benign	Het
Fmnl2	A	G	2: 53,105,537	E424G	probably damaging	Het
Fryl	C	T	5: 73,074,751	W424*	probably null	Het
Gata3	G	T	2: 9,874,768	Y97*	probably null	Het
Gm15446	T	A	5: 109,942,457	C192S	probably damaging	Het
Hdac10	A	T	15: 89,125,318	D470E	probably benign	Het
Ier2	A	G	8: 84,662,426	L109P	probably benign	Het
Kcnh2	T	C	5: 24,322,219	T559A	probably benign	Het
Khk	C	T	5: 30,930,594	A204V	probably damaging	Het
Kndc1	T	A	7: 139,927,408	M1169K	possibly damaging	Het
Krtap31-1	A	G	11: 99,908,093	S41G	probably benign	Het
Nabp1	T	C	1: 51,473,003		probably null	Het
Nphp3	A	G	9: 104,035,840	D939G	probably benign	Het
Olfr513	A	T	7: 108,755,102	N82I	probably damaging	Het
Ptk2	A	T	15: 73,262,575	D558E	probably damaging	Het
Serpinb6d	A	G	13: 33,669,129	D168G	probably benign	Het
Shisa8	G	A	15: 82,208,555	P189L	probably damaging	Het
Shkbp1	A	G	7: 27,354,779	V89A	probably benign	Het
Slc40a1	C	T	1: 45,911,297	A332T	probably damaging	Het
Slc44a3	A	T	3: 121,497,847	Y373*	probably null	Het
Slf2	T	C	19: 44,949,001	V722A	probably benign	Het
Spanxn4	A	G	12: 62,687,838		noncoding transcript	Het
Stag3	T	A	5: 138,298,639		probably null	Het
Tanc1	T	C	2: 59,797,694	I612T	possibly damaging	Het
Thbs2	T	A	17: 14,685,781	M286L	probably benign	Het
Top1	T	A	2: 160,703,595	N294K	probably benign	Het
Tpr	T	G	1: 150,426,893	L1381V	probably damaging	Het
Trpm8	T	G	1: 88,326,432	S126A	probably benign	Het
Ttc41	A	G	10: 86,775,993	Y1075C	probably damaging	Het
Ubox5	C	T	2: 130,597,456	G418D	probably benign	Het
Vmn1r67	T	C	7: 10,446,980	V57A	possibly damaging	Het
Zbtb5	T	C	4: 44,993,500	H628R	probably damaging	Het
Zfp810	T	C	9: 22,278,920	I231V	probably benign	Het

Other mutations in Plcg2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00594:Plcg2	APN	8	117556071	missense	possibly damaging	0.89
IGL00911:Plcg2	APN	8	117586515	missense	probably benign	0.17
IGL00952:Plcg2	APN	8	117607217	missense	probably benign
IGL01115:Plcg2	APN	8	117557329	missense	probably damaging	1.00
IGL01326:Plcg2	APN	8	117573999	splice site	probably benign
IGL01357:Plcg2	APN	8	117614161	splice site	probably benign
IGL01705:Plcg2	APN	8	117581662	missense	probably damaging	1.00
IGL01755:Plcg2	APN	8	117621241	missense	possibly damaging	0.48
IGL01828:Plcg2	APN	8	117590233	missense	probably damaging	1.00
IGL02307:Plcg2	APN	8	117579896	critical splice donor site	probably null
IGL02345:Plcg2	APN	8	117585180	missense	probably damaging	0.99
IGL02448:Plcg2	APN	8	117607221	missense	probably benign
IGL02587:Plcg2	APN	8	117558113	missense	possibly damaging	0.80
IGL02646:Plcg2	APN	8	117603883	missense	possibly damaging	0.88
IGL03409:Plcg2	APN	8	117583495	missense	probably damaging	0.96
Ctenophore	UTSW	8	117557318	missense	probably damaging	0.98
Porifera	UTSW	8	117579846	missense	possibly damaging	0.79
Poseidon	UTSW	8	117615238	missense	probably damaging	1.00
Poseidon2	UTSW	8	117577874	missense	possibly damaging	0.80
queen	UTSW	8	117581707	missense	probably benign	0.00
Seahorse	UTSW	8	117589835	splice site	probably null
Teleost	UTSW	8	117583549	missense	probably damaging	1.00
Theseus	UTSW	8	117596332	missense	probably damaging	0.99
trident	UTSW	8	117612978	missense	probably benign	0.00
R0172:Plcg2	UTSW	8	117579782	missense	probably benign	0.00
R0194:Plcg2	UTSW	8	117573397	splice site	probably benign
R0410:Plcg2	UTSW	8	117615373	missense	probably damaging	0.98
R0462:Plcg2	UTSW	8	117585305	missense	probably benign	0.06
R0494:Plcg2	UTSW	8	117556104	missense	probably damaging	1.00
R0522:Plcg2	UTSW	8	117614288	splice site	probably null
R0612:Plcg2	UTSW	8	117573365	missense	probably benign	0.01
R1239:Plcg2	UTSW	8	117556044	missense	probably benign
R1367:Plcg2	UTSW	8	117615238	missense	probably damaging	1.00
R1756:Plcg2	UTSW	8	117592708	missense	probably benign	0.02
R2176:Plcg2	UTSW	8	117612994	missense	probably damaging	1.00
R3500:Plcg2	UTSW	8	117612978	missense	probably benign	0.00
R4043:Plcg2	UTSW	8	117612978	missense	probably benign	0.00
R4654:Plcg2	UTSW	8	117504315	missense	probably benign
R4883:Plcg2	UTSW	8	117607133	nonsense	probably null
R4932:Plcg2	UTSW	8	117607083	missense	probably benign	0.05
R5080:Plcg2	UTSW	8	117590003	missense	probably benign	0.10
R5226:Plcg2	UTSW	8	117577874	missense	possibly damaging	0.80
R5264:Plcg2	UTSW	8	117634793	missense	possibly damaging	0.95
R5298:Plcg2	UTSW	8	117605249	missense	probably benign
R5473:Plcg2	UTSW	8	117634401	missense	probably benign
R5555:Plcg2	UTSW	8	117612995	nonsense	probably null
R5557:Plcg2	UTSW	8	117586557	missense	probably damaging	0.99
R5805:Plcg2	UTSW	8	117598495	critical splice donor site	probably null
R5826:Plcg2	UTSW	8	117610844	missense	probably benign	0.19
R5871:Plcg2	UTSW	8	117504217	missense	probably damaging	1.00
R5894:Plcg2	UTSW	8	117504349	missense	probably damaging	0.99
R6142:Plcg2	UTSW	8	117585271	missense	probably benign
R6609:Plcg2	UTSW	8	117568170	missense	probably benign	0.31
R6684:Plcg2	UTSW	8	117596332	missense	probably damaging	0.99
R6710:Plcg2	UTSW	8	117557347	missense	probably benign	0.05
R6931:Plcg2	UTSW	8	117557319	missense	probably benign	0.24
R6946:Plcg2	UTSW	8	117504190	missense	probably benign
R7036:Plcg2	UTSW	8	117596306	missense	probably benign
R7070:Plcg2	UTSW	8	117596306	missense	probably benign
R7072:Plcg2	UTSW	8	117589835	splice site	probably null
R7214:Plcg2	UTSW	8	117583549	missense	probably damaging	1.00
R7351:Plcg2	UTSW	8	117590310	missense	possibly damaging	0.95
R7393:Plcg2	UTSW	8	117579825	missense	possibly damaging	0.90
R7443:Plcg2	UTSW	8	117504289	missense	probably benign	0.00
R7513:Plcg2	UTSW	8	117579853	missense	probably damaging	0.99
R7609:Plcg2	UTSW	8	117558113	missense	probably benign	0.01
R8134:Plcg2	UTSW	8	117557318	missense	probably damaging	0.98
R8399:Plcg2	UTSW	8	117596362	missense	probably damaging	1.00
R8701:Plcg2	UTSW	8	117581677	missense	probably damaging	1.00
R8774:Plcg2	UTSW	8	117579846	missense	possibly damaging	0.79
R8774-TAIL:Plcg2	UTSW	8	117579846	missense	possibly damaging	0.79
R8938:Plcg2	UTSW	8	117504375	critical splice donor site	probably null
R9003:Plcg2	UTSW	8	117615263	missense
R9286:Plcg2	UTSW	8	117605237	missense	probably benign	0.19
R9318:Plcg2	UTSW	8	117596368	missense	probably benign
RF008:Plcg2	UTSW	8	117573524	splice site	probably null
X0027:Plcg2	UTSW	8	117555983	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CCACAAAGCACTACTCTGTGGTCC -3'
(R):5'- CATAACCCACGTATCGGTCTGCTC -3'

Sequencing Primer
(F):5'- AGCACTACTCTGTGGTCCAAATTC -3'
(R):5'- aggaaacaggacaacccaag -3'

Posted On

2014-04-24