Incidental Mutation 'R1608:Zfp810'
ID176630
Institutional Source Beutler Lab
Gene Symbol Zfp810
Ensembl Gene ENSMUSG00000066829
Gene Namezinc finger protein 810
Synonyms
MMRRC Submission 039645-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R1608 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location22276748-22307648 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22278920 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 231 (I231V)
Ref Sequence ENSEMBL: ENSMUSP00000083459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086278] [ENSMUST00000215202]
Predicted Effect probably benign
Transcript: ENSMUST00000086278
AA Change: I231V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000083459
Gene: ENSMUSG00000066829
AA Change: I231V

DomainStartEndE-ValueType
KRAB 4 64 1.09e-33 SMART
ZnF_C2H2 126 148 2.44e2 SMART
ZnF_C2H2 182 204 3.07e-1 SMART
ZnF_C2H2 210 232 8.47e-4 SMART
ZnF_C2H2 238 260 6.78e-3 SMART
ZnF_C2H2 266 288 6.13e-1 SMART
ZnF_C2H2 294 316 5.06e-2 SMART
ZnF_C2H2 322 344 4.79e-3 SMART
ZnF_C2H2 350 372 2.99e-4 SMART
ZnF_C2H2 378 400 1.33e-1 SMART
ZnF_C2H2 406 428 2.75e-3 SMART
ZnF_C2H2 434 456 1.58e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214499
Predicted Effect probably benign
Transcript: ENSMUST00000215202
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 A G 9: 30,902,479 S797P probably damaging Het
Akap9 T C 5: 3,961,783 Y829H probably damaging Het
Anp32a A G 9: 62,372,093 D74G probably damaging Het
B230118H07Rik T C 2: 101,610,571 E29G probably damaging Het
B3gat1 T C 9: 26,751,816 I13T probably damaging Het
Cbfa2t3 A T 8: 122,647,709 V99D probably damaging Het
Celsr2 C T 3: 108,402,483 C1600Y probably damaging Het
Ddx31 T A 2: 28,859,066 N291K probably damaging Het
Dennd1a T G 2: 37,852,434 M3L probably benign Het
Dnah12 C T 14: 26,766,190 P1017L probably damaging Het
Dnajc6 A T 4: 101,599,167 D86V probably damaging Het
Evx2 T G 2: 74,657,851 K208N probably damaging Het
F13a1 A G 13: 36,868,811 V718A probably damaging Het
Fcho2 T C 13: 98,726,198 D757G probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Fryl C T 5: 73,074,751 W424* probably null Het
Gata3 G T 2: 9,874,768 Y97* probably null Het
Gm15446 T A 5: 109,942,457 C192S probably damaging Het
Hdac10 A T 15: 89,125,318 D470E probably benign Het
Ier2 A G 8: 84,662,426 L109P probably benign Het
Kcnh2 T C 5: 24,322,219 T559A probably benign Het
Khk C T 5: 30,930,594 A204V probably damaging Het
Kndc1 T A 7: 139,927,408 M1169K possibly damaging Het
Krtap31-1 A G 11: 99,908,093 S41G probably benign Het
Nabp1 T C 1: 51,473,003 probably null Het
Nphp3 A G 9: 104,035,840 D939G probably benign Het
Olfr513 A T 7: 108,755,102 N82I probably damaging Het
Plcg2 T C 8: 117,614,235 I1089T possibly damaging Het
Ptk2 A T 15: 73,262,575 D558E probably damaging Het
Serpinb6d A G 13: 33,669,129 D168G probably benign Het
Shisa8 G A 15: 82,208,555 P189L probably damaging Het
Shkbp1 A G 7: 27,354,779 V89A probably benign Het
Slc40a1 C T 1: 45,911,297 A332T probably damaging Het
Slc44a3 A T 3: 121,497,847 Y373* probably null Het
Slf2 T C 19: 44,949,001 V722A probably benign Het
Spanxn4 A G 12: 62,687,838 noncoding transcript Het
Stag3 T A 5: 138,298,639 probably null Het
Tanc1 T C 2: 59,797,694 I612T possibly damaging Het
Thbs2 T A 17: 14,685,781 M286L probably benign Het
Top1 T A 2: 160,703,595 N294K probably benign Het
Tpr T G 1: 150,426,893 L1381V probably damaging Het
Trpm8 T G 1: 88,326,432 S126A probably benign Het
Ttc41 A G 10: 86,775,993 Y1075C probably damaging Het
Ubox5 C T 2: 130,597,456 G418D probably benign Het
Vmn1r67 T C 7: 10,446,980 V57A possibly damaging Het
Zbtb5 T C 4: 44,993,500 H628R probably damaging Het
Other mutations in Zfp810
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Zfp810 APN 9 22278309 nonsense probably null
IGL03079:Zfp810 APN 9 22284127 missense probably damaging 1.00
IGL03402:Zfp810 APN 9 22279145 splice site probably null
H8562:Zfp810 UTSW 9 22279091 missense probably benign 0.42
R1116:Zfp810 UTSW 9 22279085 missense probably benign 0.11
R1160:Zfp810 UTSW 9 22278532 missense possibly damaging 0.64
R1171:Zfp810 UTSW 9 22278826 missense possibly damaging 0.95
R1393:Zfp810 UTSW 9 22280514 missense probably benign
R1644:Zfp810 UTSW 9 22279028 missense possibly damaging 0.67
R1766:Zfp810 UTSW 9 22278532 missense possibly damaging 0.64
R2568:Zfp810 UTSW 9 22279238 missense probably benign 0.01
R3684:Zfp810 UTSW 9 22278235 missense probably benign 0.01
R4002:Zfp810 UTSW 9 22278892 missense probably damaging 1.00
R4134:Zfp810 UTSW 9 22279073 missense probably damaging 0.97
R4135:Zfp810 UTSW 9 22279073 missense probably damaging 0.97
R4334:Zfp810 UTSW 9 22278784 missense probably benign 0.00
R4545:Zfp810 UTSW 9 22278745 missense probably damaging 0.96
R5399:Zfp810 UTSW 9 22278829 missense possibly damaging 0.91
R5622:Zfp810 UTSW 9 22279096 missense probably benign 0.00
R5643:Zfp810 UTSW 9 22283171 missense probably benign 0.26
R7375:Zfp810 UTSW 9 22290537 critical splice donor site probably null
R7441:Zfp810 UTSW 9 22279272 nonsense probably null
R7809:Zfp810 UTSW 9 22278982 missense possibly damaging 0.51
R8422:Zfp810 UTSW 9 22283222 nonsense probably null
R8526:Zfp810 UTSW 9 22278290 missense probably damaging 1.00
R8719:Zfp810 UTSW 9 22279275 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATGGAGATGAGCTAGAGACCTTTCTT -3'
(R):5'- GAAGCCACAGTATAGCACAAAGCAGA -3'

Sequencing Primer
(F):5'- gctttcctgcactctttacattc -3'
(R):5'- CCTCAGTCAGTATCAGAGGCTTG -3'
Posted On2014-04-24