Incidental Mutation 'R1608:Adamts15'
ID176632
Institutional Source Beutler Lab
Gene Symbol Adamts15
Ensembl Gene ENSMUSG00000033453
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 15
Synonyms
MMRRC Submission 039645-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1608 (G1)
Quality Score200
Status Not validated
Chromosome9
Chromosomal Location30899155-30922452 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30902479 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 797 (S797P)
Ref Sequence ENSEMBL: ENSMUSP00000067022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065112]
Predicted Effect probably damaging
Transcript: ENSMUST00000065112
AA Change: S797P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067022
Gene: ENSMUSG00000033453
AA Change: S797P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Pep_M12B_propep 24 157 8.7e-27 PFAM
Pfam:Reprolysin_4 216 422 8.2e-7 PFAM
Pfam:Reprolysin_5 217 404 7.2e-13 PFAM
Pfam:Reprolysin 218 427 3.7e-20 PFAM
Pfam:Reprolysin_3 240 372 6.1e-10 PFAM
Blast:ACR 429 507 1e-25 BLAST
TSP1 519 571 7.85e-12 SMART
Pfam:ADAM_spacer1 683 801 7.1e-36 PFAM
TSP1 842 895 3e-8 SMART
TSP1 896 949 4.21e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217070
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active versicanase enzyme. This gene is located adjacent to a related ADAMTS gene (Adamts8) on chromosome 9. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T C 5: 3,961,783 Y829H probably damaging Het
Anp32a A G 9: 62,372,093 D74G probably damaging Het
B230118H07Rik T C 2: 101,610,571 E29G probably damaging Het
B3gat1 T C 9: 26,751,816 I13T probably damaging Het
Cbfa2t3 A T 8: 122,647,709 V99D probably damaging Het
Celsr2 C T 3: 108,402,483 C1600Y probably damaging Het
Ddx31 T A 2: 28,859,066 N291K probably damaging Het
Dennd1a T G 2: 37,852,434 M3L probably benign Het
Dnah12 C T 14: 26,766,190 P1017L probably damaging Het
Dnajc6 A T 4: 101,599,167 D86V probably damaging Het
Evx2 T G 2: 74,657,851 K208N probably damaging Het
F13a1 A G 13: 36,868,811 V718A probably damaging Het
Fcho2 T C 13: 98,726,198 D757G probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Fryl C T 5: 73,074,751 W424* probably null Het
Gata3 G T 2: 9,874,768 Y97* probably null Het
Gm15446 T A 5: 109,942,457 C192S probably damaging Het
Hdac10 A T 15: 89,125,318 D470E probably benign Het
Ier2 A G 8: 84,662,426 L109P probably benign Het
Kcnh2 T C 5: 24,322,219 T559A probably benign Het
Khk C T 5: 30,930,594 A204V probably damaging Het
Kndc1 T A 7: 139,927,408 M1169K possibly damaging Het
Krtap31-1 A G 11: 99,908,093 S41G probably benign Het
Nabp1 T C 1: 51,473,003 probably null Het
Nphp3 A G 9: 104,035,840 D939G probably benign Het
Olfr513 A T 7: 108,755,102 N82I probably damaging Het
Plcg2 T C 8: 117,614,235 I1089T possibly damaging Het
Ptk2 A T 15: 73,262,575 D558E probably damaging Het
Serpinb6d A G 13: 33,669,129 D168G probably benign Het
Shisa8 G A 15: 82,208,555 P189L probably damaging Het
Shkbp1 A G 7: 27,354,779 V89A probably benign Het
Slc40a1 C T 1: 45,911,297 A332T probably damaging Het
Slc44a3 A T 3: 121,497,847 Y373* probably null Het
Slf2 T C 19: 44,949,001 V722A probably benign Het
Spanxn4 A G 12: 62,687,838 noncoding transcript Het
Stag3 T A 5: 138,298,639 probably null Het
Tanc1 T C 2: 59,797,694 I612T possibly damaging Het
Thbs2 T A 17: 14,685,781 M286L probably benign Het
Top1 T A 2: 160,703,595 N294K probably benign Het
Tpr T G 1: 150,426,893 L1381V probably damaging Het
Trpm8 T G 1: 88,326,432 S126A probably benign Het
Ttc41 A G 10: 86,775,993 Y1075C probably damaging Het
Ubox5 C T 2: 130,597,456 G418D probably benign Het
Vmn1r67 T C 7: 10,446,980 V57A possibly damaging Het
Zbtb5 T C 4: 44,993,500 H628R probably damaging Het
Zfp810 T C 9: 22,278,920 I231V probably benign Het
Other mutations in Adamts15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Adamts15 APN 9 30902053 missense probably damaging 1.00
IGL01325:Adamts15 APN 9 30921688 missense possibly damaging 0.86
IGL01506:Adamts15 APN 9 30922134 missense probably benign 0.08
IGL01897:Adamts15 APN 9 30902152 missense probably damaging 1.00
IGL02137:Adamts15 APN 9 30910660 missense probably damaging 1.00
IGL02876:Adamts15 APN 9 30904522 missense probably damaging 0.98
IGL02997:Adamts15 APN 9 30906057 splice site probably benign
IGL03094:Adamts15 APN 9 30904472 splice site probably benign
IGL03146:Adamts15 APN 9 30921567 missense probably damaging 0.99
IGL03241:Adamts15 APN 9 30904485 missense probably damaging 1.00
Pugsley UTSW 9 30906158 missense probably damaging 1.00
R0118:Adamts15 UTSW 9 30911744 missense probably damaging 1.00
R0635:Adamts15 UTSW 9 30904770 missense probably damaging 1.00
R0827:Adamts15 UTSW 9 30921480 missense probably damaging 1.00
R0946:Adamts15 UTSW 9 30902197 missense probably damaging 1.00
R1806:Adamts15 UTSW 9 30904815 missense probably damaging 1.00
R1954:Adamts15 UTSW 9 30910708 missense probably benign
R1967:Adamts15 UTSW 9 30921309 nonsense probably null
R2009:Adamts15 UTSW 9 30922137 missense probably benign 0.17
R2129:Adamts15 UTSW 9 30904503 missense probably benign 0.05
R2329:Adamts15 UTSW 9 30902485 missense probably damaging 1.00
R2991:Adamts15 UTSW 9 30921394 missense probably benign
R3970:Adamts15 UTSW 9 30910602 missense probably benign 0.40
R4212:Adamts15 UTSW 9 30906174 missense probably damaging 0.99
R4326:Adamts15 UTSW 9 30904518 missense probably benign
R4329:Adamts15 UTSW 9 30904518 missense probably benign
R4594:Adamts15 UTSW 9 30921447 missense probably damaging 0.99
R5110:Adamts15 UTSW 9 30921444 missense probably benign 0.01
R5120:Adamts15 UTSW 9 30921576 missense probably damaging 1.00
R5697:Adamts15 UTSW 9 30911794 missense probably damaging 1.00
R5901:Adamts15 UTSW 9 30902490 missense probably damaging 1.00
R6011:Adamts15 UTSW 9 30902786 missense probably damaging 0.98
R6020:Adamts15 UTSW 9 30902062 missense probably benign 0.03
R6651:Adamts15 UTSW 9 30922152 missense probably damaging 0.98
R6665:Adamts15 UTSW 9 30904479 critical splice donor site probably null
R7021:Adamts15 UTSW 9 30921480 missense probably damaging 1.00
R7231:Adamts15 UTSW 9 30906158 missense probably damaging 1.00
R7290:Adamts15 UTSW 9 30902610 missense probably benign 0.05
R7390:Adamts15 UTSW 9 30911108 critical splice donor site probably null
R7798:Adamts15 UTSW 9 30904643 missense probably damaging 1.00
R7833:Adamts15 UTSW 9 30922105 missense probably benign
R7908:Adamts15 UTSW 9 30902226 missense probably benign
R8175:Adamts15 UTSW 9 30904656 missense probably damaging 1.00
R8177:Adamts15 UTSW 9 30922026 missense probably damaging 1.00
R8347:Adamts15 UTSW 9 30902550 missense probably benign 0.07
R8374:Adamts15 UTSW 9 30902706 missense probably benign 0.21
X0063:Adamts15 UTSW 9 30922230 missense possibly damaging 0.96
X0067:Adamts15 UTSW 9 30921582 missense probably damaging 1.00
Z1176:Adamts15 UTSW 9 30910700 missense probably damaging 1.00
Z1177:Adamts15 UTSW 9 30902491 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAATGGCCGATGGTCTACATCAC -3'
(R):5'- GGCAAATACCTGCTCAATGGGCAC -3'

Sequencing Primer
(F):5'- TGGTCTACATCACAAGCAGAG -3'
(R):5'- CAATGGGCACTTTGTGGTATCC -3'
Posted On2014-04-24