Mutagenetix > Incidental Mutation

Incidental Mutation 'R1608:Adamts15'

176632

Institutional Source

Beutler Lab

Gene Symbol

Adamts15

Ensembl Gene

ENSMUSG00000033453

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 15

Synonyms

MMRRC Submission

039645-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1608 (G1)

Quality Score

200

Status

Not validated

Chromosome

Chromosomal Location

30899155-30922452 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30902479 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 797 (S797P)

Ref Sequence

ENSEMBL: ENSMUSP00000067022 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065112]

AlphaFold

P59384

Predicted Effect

probably damaging
Transcript: ENSMUST00000065112
AA Change: S797P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000067022
Gene: ENSMUSG00000033453
AA Change: S797P

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:Pep_M12B_propep	24	157	8.7e-27	PFAM
Pfam:Reprolysin_4	216	422	8.2e-7	PFAM
Pfam:Reprolysin_5	217	404	7.2e-13	PFAM
Pfam:Reprolysin	218	427	3.7e-20	PFAM
Pfam:Reprolysin_3	240	372	6.1e-10	PFAM
Blast:ACR	429	507	1e-25	BLAST
TSP1	519	571	7.85e-12	SMART
Pfam:ADAM_spacer1	683	801	7.1e-36	PFAM
TSP1	842	895	3e-8	SMART
TSP1	896	949	4.21e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217070

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 89.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active versicanase enzyme. This gene is located adjacent to a related ADAMTS gene (Adamts8) on chromosome 9. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap9	T	C	5: 3,961,783	Y829H	probably damaging	Het
Anp32a	A	G	9: 62,372,093	D74G	probably damaging	Het
B230118H07Rik	T	C	2: 101,610,571	E29G	probably damaging	Het
B3gat1	T	C	9: 26,751,816	I13T	probably damaging	Het
Cbfa2t3	A	T	8: 122,647,709	V99D	probably damaging	Het
Celsr2	C	T	3: 108,402,483	C1600Y	probably damaging	Het
Ddx31	T	A	2: 28,859,066	N291K	probably damaging	Het
Dennd1a	T	G	2: 37,852,434	M3L	probably benign	Het
Dnah12	C	T	14: 26,766,190	P1017L	probably damaging	Het
Dnajc6	A	T	4: 101,599,167	D86V	probably damaging	Het
Evx2	T	G	2: 74,657,851	K208N	probably damaging	Het
F13a1	A	G	13: 36,868,811	V718A	probably damaging	Het
Fcho2	T	C	13: 98,726,198	D757G	probably benign	Het
Fmnl2	A	G	2: 53,105,537	E424G	probably damaging	Het
Fryl	C	T	5: 73,074,751	W424*	probably null	Het
Gata3	G	T	2: 9,874,768	Y97*	probably null	Het
Gm15446	T	A	5: 109,942,457	C192S	probably damaging	Het
Hdac10	A	T	15: 89,125,318	D470E	probably benign	Het
Ier2	A	G	8: 84,662,426	L109P	probably benign	Het
Kcnh2	T	C	5: 24,322,219	T559A	probably benign	Het
Khk	C	T	5: 30,930,594	A204V	probably damaging	Het
Kndc1	T	A	7: 139,927,408	M1169K	possibly damaging	Het
Krtap31-1	A	G	11: 99,908,093	S41G	probably benign	Het
Nabp1	T	C	1: 51,473,003		probably null	Het
Nphp3	A	G	9: 104,035,840	D939G	probably benign	Het
Olfr513	A	T	7: 108,755,102	N82I	probably damaging	Het
Plcg2	T	C	8: 117,614,235	I1089T	possibly damaging	Het
Ptk2	A	T	15: 73,262,575	D558E	probably damaging	Het
Serpinb6d	A	G	13: 33,669,129	D168G	probably benign	Het
Shisa8	G	A	15: 82,208,555	P189L	probably damaging	Het
Shkbp1	A	G	7: 27,354,779	V89A	probably benign	Het
Slc40a1	C	T	1: 45,911,297	A332T	probably damaging	Het
Slc44a3	A	T	3: 121,497,847	Y373*	probably null	Het
Slf2	T	C	19: 44,949,001	V722A	probably benign	Het
Spanxn4	A	G	12: 62,687,838		noncoding transcript	Het
Stag3	T	A	5: 138,298,639		probably null	Het
Tanc1	T	C	2: 59,797,694	I612T	possibly damaging	Het
Thbs2	T	A	17: 14,685,781	M286L	probably benign	Het
Top1	T	A	2: 160,703,595	N294K	probably benign	Het
Tpr	T	G	1: 150,426,893	L1381V	probably damaging	Het
Trpm8	T	G	1: 88,326,432	S126A	probably benign	Het
Ttc41	A	G	10: 86,775,993	Y1075C	probably damaging	Het
Ubox5	C	T	2: 130,597,456	G418D	probably benign	Het
Vmn1r67	T	C	7: 10,446,980	V57A	possibly damaging	Het
Zbtb5	T	C	4: 44,993,500	H628R	probably damaging	Het
Zfp810	T	C	9: 22,278,920	I231V	probably benign	Het

Other mutations in Adamts15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00930:Adamts15	APN	9	30902053	missense	probably damaging	1.00
IGL01325:Adamts15	APN	9	30921688	missense	possibly damaging	0.86
IGL01506:Adamts15	APN	9	30922134	missense	probably benign	0.08
IGL01897:Adamts15	APN	9	30902152	missense	probably damaging	1.00
IGL02137:Adamts15	APN	9	30910660	missense	probably damaging	1.00
IGL02876:Adamts15	APN	9	30904522	missense	probably damaging	0.98
IGL02997:Adamts15	APN	9	30906057	splice site	probably benign
IGL03094:Adamts15	APN	9	30904472	splice site	probably benign
IGL03146:Adamts15	APN	9	30921567	missense	probably damaging	0.99
IGL03241:Adamts15	APN	9	30904485	missense	probably damaging	1.00
Awareness	UTSW	9	30911108	critical splice donor site	probably null
heightened	UTSW	9	30904770	missense	probably damaging	1.00
Pugsley	UTSW	9	30906158	missense	probably damaging	1.00
sparticus	UTSW	9	30910602	missense	probably benign	0.40
R0118:Adamts15	UTSW	9	30911744	missense	probably damaging	1.00
R0635:Adamts15	UTSW	9	30904770	missense	probably damaging	1.00
R0827:Adamts15	UTSW	9	30921480	missense	probably damaging	1.00
R0946:Adamts15	UTSW	9	30902197	missense	probably damaging	1.00
R1806:Adamts15	UTSW	9	30904815	missense	probably damaging	1.00
R1954:Adamts15	UTSW	9	30910708	missense	probably benign
R1967:Adamts15	UTSW	9	30921309	nonsense	probably null
R2009:Adamts15	UTSW	9	30922137	missense	probably benign	0.17
R2129:Adamts15	UTSW	9	30904503	missense	probably benign	0.05
R2329:Adamts15	UTSW	9	30902485	missense	probably damaging	1.00
R2991:Adamts15	UTSW	9	30921394	missense	probably benign
R3970:Adamts15	UTSW	9	30910602	missense	probably benign	0.40
R4212:Adamts15	UTSW	9	30906174	missense	probably damaging	0.99
R4326:Adamts15	UTSW	9	30904518	missense	probably benign
R4329:Adamts15	UTSW	9	30904518	missense	probably benign
R4594:Adamts15	UTSW	9	30921447	missense	probably damaging	0.99
R5110:Adamts15	UTSW	9	30921444	missense	probably benign	0.01
R5120:Adamts15	UTSW	9	30921576	missense	probably damaging	1.00
R5697:Adamts15	UTSW	9	30911794	missense	probably damaging	1.00
R5901:Adamts15	UTSW	9	30902490	missense	probably damaging	1.00
R6011:Adamts15	UTSW	9	30902786	missense	probably damaging	0.98
R6020:Adamts15	UTSW	9	30902062	missense	probably benign	0.03
R6651:Adamts15	UTSW	9	30922152	missense	probably damaging	0.98
R6665:Adamts15	UTSW	9	30904479	critical splice donor site	probably null
R7021:Adamts15	UTSW	9	30921480	missense	probably damaging	1.00
R7231:Adamts15	UTSW	9	30906158	missense	probably damaging	1.00
R7290:Adamts15	UTSW	9	30902610	missense	probably benign	0.05
R7390:Adamts15	UTSW	9	30911108	critical splice donor site	probably null
R7798:Adamts15	UTSW	9	30904643	missense	probably damaging	1.00
R7833:Adamts15	UTSW	9	30922105	missense	probably benign
R7908:Adamts15	UTSW	9	30902226	missense	probably benign
R8175:Adamts15	UTSW	9	30904656	missense	probably damaging	1.00
R8177:Adamts15	UTSW	9	30922026	missense	probably damaging	1.00
R8347:Adamts15	UTSW	9	30902550	missense	probably benign	0.07
R8348:Adamts15	UTSW	9	30902550	missense	probably benign	0.07
R8374:Adamts15	UTSW	9	30902706	missense	probably benign	0.21
R8473:Adamts15	UTSW	9	30904789	missense	probably damaging	1.00
R8680:Adamts15	UTSW	9	30911759	missense	possibly damaging	0.57
R9113:Adamts15	UTSW	9	30911202	missense	probably damaging	1.00
R9336:Adamts15	UTSW	9	30904789	missense	probably damaging	1.00
R9381:Adamts15	UTSW	9	30902520	missense	probably damaging	0.99
X0063:Adamts15	UTSW	9	30922230	missense	possibly damaging	0.96
X0067:Adamts15	UTSW	9	30921582	missense	probably damaging	1.00
Z1176:Adamts15	UTSW	9	30910700	missense	probably damaging	1.00
Z1177:Adamts15	UTSW	9	30902491	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAATGGCCGATGGTCTACATCAC -3'
(R):5'- GGCAAATACCTGCTCAATGGGCAC -3'

Sequencing Primer
(F):5'- TGGTCTACATCACAAGCAGAG -3'
(R):5'- CAATGGGCACTTTGTGGTATCC -3'

Posted On

2014-04-24