Incidental Mutation 'R1608:Anp32a'
ID176633
Institutional Source Beutler Lab
Gene Symbol Anp32a
Ensembl Gene ENSMUSG00000032249
Gene Nameacidic (leucine-rich) nuclear phosphoprotein 32 family, member A
Synonymspp32, Anp32
MMRRC Submission 039645-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1608 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location62341293-62378812 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62372093 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 74 (D74G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085519] [ENSMUST00000128636] [ENSMUST00000135395]
Predicted Effect probably benign
Transcript: ENSMUST00000085519
AA Change: D79G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000082652
Gene: ENSMUSG00000032249
AA Change: D79G

DomainStartEndE-ValueType
Pfam:LRR_4 64 107 5.2e-9 PFAM
Pfam:LRR_8 64 125 1.9e-9 PFAM
LRRcap 128 146 3.19e-2 SMART
coiled coil region 167 199 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126451
Predicted Effect probably benign
Transcript: ENSMUST00000128636
AA Change: D82G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123574
Gene: ENSMUSG00000032249
AA Change: D82G

DomainStartEndE-ValueType
Pfam:LRR_8 67 128 3.1e-10 PFAM
Pfam:LRR_4 77 111 3e-8 PFAM
Pfam:LRR_6 90 110 7.2e-6 PFAM
Pfam:LRR_7 91 107 9.5e-4 PFAM
Pfam:LRR_1 92 115 1.7e-4 PFAM
LRRcap 131 149 3.19e-2 SMART
coiled coil region 170 198 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129026
Predicted Effect probably benign
Transcript: ENSMUST00000135395
AA Change: D65G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122165
Gene: ENSMUSG00000032249
AA Change: D65G

DomainStartEndE-ValueType
Pfam:LRR_8 50 111 4.9e-10 PFAM
Pfam:LRR_6 73 93 9e-6 PFAM
Pfam:LRR_7 74 90 1.2e-3 PFAM
Pfam:LRR_1 75 98 2.2e-4 PFAM
LRRcap 114 132 3.19e-2 SMART
coiled coil region 153 185 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145679
Predicted Effect probably damaging
Transcript: ENSMUST00000156461
AA Change: D74G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115293
Gene: ENSMUSG00000032249
AA Change: D74G

DomainStartEndE-ValueType
Pfam:LRR_9 5 138 8e-13 PFAM
Pfam:LRR_4 60 104 9.7e-10 PFAM
Pfam:LRR_8 60 121 8.6e-10 PFAM
Pfam:LRR_4 84 129 2.8e-9 PFAM
Pfam:LRR_1 85 106 1.4e-3 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice are viable, fertile, behaviorally normal, and show no defects of the central nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 A G 9: 30,902,479 S797P probably damaging Het
Akap9 T C 5: 3,961,783 Y829H probably damaging Het
B230118H07Rik T C 2: 101,610,571 E29G probably damaging Het
B3gat1 T C 9: 26,751,816 I13T probably damaging Het
Cbfa2t3 A T 8: 122,647,709 V99D probably damaging Het
Celsr2 C T 3: 108,402,483 C1600Y probably damaging Het
Ddx31 T A 2: 28,859,066 N291K probably damaging Het
Dennd1a T G 2: 37,852,434 M3L probably benign Het
Dnah12 C T 14: 26,766,190 P1017L probably damaging Het
Dnajc6 A T 4: 101,599,167 D86V probably damaging Het
Evx2 T G 2: 74,657,851 K208N probably damaging Het
F13a1 A G 13: 36,868,811 V718A probably damaging Het
Fcho2 T C 13: 98,726,198 D757G probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Fryl C T 5: 73,074,751 W424* probably null Het
Gata3 G T 2: 9,874,768 Y97* probably null Het
Gm15446 T A 5: 109,942,457 C192S probably damaging Het
Hdac10 A T 15: 89,125,318 D470E probably benign Het
Ier2 A G 8: 84,662,426 L109P probably benign Het
Kcnh2 T C 5: 24,322,219 T559A probably benign Het
Khk C T 5: 30,930,594 A204V probably damaging Het
Kndc1 T A 7: 139,927,408 M1169K possibly damaging Het
Krtap31-1 A G 11: 99,908,093 S41G probably benign Het
Nabp1 T C 1: 51,473,003 probably null Het
Nphp3 A G 9: 104,035,840 D939G probably benign Het
Olfr513 A T 7: 108,755,102 N82I probably damaging Het
Plcg2 T C 8: 117,614,235 I1089T possibly damaging Het
Ptk2 A T 15: 73,262,575 D558E probably damaging Het
Serpinb6d A G 13: 33,669,129 D168G probably benign Het
Shisa8 G A 15: 82,208,555 P189L probably damaging Het
Shkbp1 A G 7: 27,354,779 V89A probably benign Het
Slc40a1 C T 1: 45,911,297 A332T probably damaging Het
Slc44a3 A T 3: 121,497,847 Y373* probably null Het
Slf2 T C 19: 44,949,001 V722A probably benign Het
Spanxn4 A G 12: 62,687,838 noncoding transcript Het
Stag3 T A 5: 138,298,639 probably null Het
Tanc1 T C 2: 59,797,694 I612T possibly damaging Het
Thbs2 T A 17: 14,685,781 M286L probably benign Het
Top1 T A 2: 160,703,595 N294K probably benign Het
Tpr T G 1: 150,426,893 L1381V probably damaging Het
Trpm8 T G 1: 88,326,432 S126A probably benign Het
Ttc41 A G 10: 86,775,993 Y1075C probably damaging Het
Ubox5 C T 2: 130,597,456 G418D probably benign Het
Vmn1r67 T C 7: 10,446,980 V57A possibly damaging Het
Zbtb5 T C 4: 44,993,500 H628R probably damaging Het
Zfp810 T C 9: 22,278,920 I231V probably benign Het
Other mutations in Anp32a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Anp32a APN 9 62371712 splice site probably benign
IGL01799:Anp32a APN 9 62371810 missense probably benign 0.06
IGL02066:Anp32a APN 9 62377333 unclassified probably benign
IGL02536:Anp32a APN 9 62371828 missense probably damaging 0.98
R2149:Anp32a UTSW 9 62371802 missense probably benign 0.19
R5287:Anp32a UTSW 9 62341993 missense possibly damaging 0.50
R5381:Anp32a UTSW 9 62372177 missense probably damaging 0.97
R5403:Anp32a UTSW 9 62341993 missense possibly damaging 0.50
R5427:Anp32a UTSW 9 62377316 unclassified probably benign
R6856:Anp32a UTSW 9 62372115 missense possibly damaging 0.95
R6906:Anp32a UTSW 9 62377569 unclassified probably benign
R7949:Anp32a UTSW 9 62373666 missense unknown
R8134:Anp32a UTSW 9 62377581 missense unknown
Predicted Primers PCR Primer
(F):5'- GGTGAAAGAGCTGGTCCTGGATAAC -3'
(R):5'- TGGTCCAACTGAATTCTCCGTGAAC -3'

Sequencing Primer
(F):5'- AGCTGGTCCTGGATAACTGTAAG -3'
(R):5'- TGTTAGCTCACAGCACAGG -3'
Posted On2014-04-24