Mutagenetix > Incidental Mutation

Incidental Mutation 'R1608:Nphp3'

176634

Institutional Source

Beutler Lab

Gene Symbol

Nphp3

Ensembl Gene

ENSMUSG00000032558

Gene Name

nephronophthisis 3 (adolescent)

Synonyms

3632410F03Rik, D330020E01Rik, pcy, nephrocystin 3

MMRRC Submission

039645-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1608 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

104002544-104043818 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 104035840 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 939 (D939G)

Ref Sequence

ENSEMBL: ENSMUSP00000035167 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035167] [ENSMUST00000193439] [ENSMUST00000194183] [ENSMUST00000194774] [ENSMUST00000216593]

AlphaFold

Q7TNH6

Predicted Effect

probably benign
Transcript: ENSMUST00000035167
AA Change: D939G

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000035167
Gene: ENSMUSG00000032558
AA Change: D939G

Domain	Start	End	E-Value	Type
low complexity region	46	69	N/A	INTRINSIC
coiled coil region	107	203	N/A	INTRINSIC
low complexity region	512	537	N/A	INTRINSIC
low complexity region	613	627	N/A	INTRINSIC
low complexity region	640	650	N/A	INTRINSIC
TPR	938	971	3.16e1	SMART
TPR	980	1013	7.74e-2	SMART
TPR	1022	1055	3.24e1	SMART
low complexity region	1066	1080	N/A	INTRINSIC
TPR	1088	1121	3.67e-3	SMART
TPR	1130	1163	1.3e-3	SMART
TPR	1172	1205	4.38e-1	SMART
TPR	1214	1247	8.69e-5	SMART
TPR	1256	1289	9.03e-3	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000129819
AA Change: D819G

SMART Domains

Protein: ENSMUSP00000116459
Gene: ENSMUSG00000032558
AA Change: D819G

Domain	Start	End	E-Value	Type
coiled coil region	75	109	N/A	INTRINSIC
low complexity region	418	443	N/A	INTRINSIC
low complexity region	519	532	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000147249

SMART Domains

Protein: ENSMUSP00000115381
Gene: ENSMUSG00000101152

Domain	Start	End	E-Value	Type
Pfam:TPR_12	1	48	3e-14	PFAM
Pfam:TPR_12	12	75	2.1e-14	PFAM
Pfam:TPR_10	15	56	7.8e-13	PFAM
Pfam:TPR_1	16	49	4.4e-9	PFAM
Pfam:TPR_7	18	58	7e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192485

Predicted Effect

probably benign
Transcript: ENSMUST00000193439

SMART Domains

Protein: ENSMUSP00000141540
Gene: ENSMUSG00000032558

Domain	Start	End	E-Value	Type
coiled coil region	75	109	N/A	INTRINSIC
low complexity region	418	443	N/A	INTRINSIC
low complexity region	519	532	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193642

Predicted Effect

probably benign
Transcript: ENSMUST00000194183

SMART Domains

Protein: ENSMUSP00000142049
Gene: ENSMUSG00000032558

Domain	Start	End	E-Value	Type
Pfam:TPR_10	1	37	3.4e-5	PFAM
Pfam:TPR_12	1	71	1.8e-14	PFAM
Pfam:TPR_10	38	79	6.5e-8	PFAM
Pfam:TPR_1	39	72	6.8e-4	PFAM
Pfam:TPR_10	81	115	9e-3	PFAM
Pfam:TPR_7	83	118	1.6e-2	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000194774
AA Change: D819G

SMART Domains

Protein: ENSMUSP00000141596
Gene: ENSMUSG00000032558
AA Change: D819G

Domain	Start	End	E-Value	Type
coiled coil region	49	83	N/A	INTRINSIC
Pfam:NACHT	400	559	2e-6	PFAM
TPR	818	851	3.16e1	SMART
TPR	860	893	7.74e-2	SMART
TPR	902	935	3.24e1	SMART
low complexity region	946	960	N/A	INTRINSIC
TPR	968	1001	3.67e-3	SMART
TPR	1010	1043	1.3e-3	SMART
TPR	1052	1085	4.38e-1	SMART
TPR	1094	1127	8.69e-5	SMART
TPR	1136	1169	9.03e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000216593

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 89.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a coiled-coil (CC) domain, a tubulin-tyrosine ligase (TTL) domain, and a tetratrico peptide repeat (TPR) domain. The encoded protein interacts with nephrocystin, it is required for normal ciliary development, and it functions in renal tubular development. Mutations in this gene are associated with nephronophthisis type 3, and also with renal-hepatic-pancreatic dysplasia, and Meckel syndrome type 7. Naturally occurring read-through transcripts exist between this gene and the downstream ACAD11 (acyl-CoA dehydrogenase family, member 11) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice display slowly progressing kidney cysts, enlarged kidneys, increased blood urea nitrogen, kidney inflammation and associated fibrosis, and premature death. Homozygous null mice display mid gestational lethality with partial penetrance of situs inversus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts15	A	G	9: 30,902,479	S797P	probably damaging	Het
Akap9	T	C	5: 3,961,783	Y829H	probably damaging	Het
Anp32a	A	G	9: 62,372,093	D74G	probably damaging	Het
B230118H07Rik	T	C	2: 101,610,571	E29G	probably damaging	Het
B3gat1	T	C	9: 26,751,816	I13T	probably damaging	Het
Cbfa2t3	A	T	8: 122,647,709	V99D	probably damaging	Het
Celsr2	C	T	3: 108,402,483	C1600Y	probably damaging	Het
Ddx31	T	A	2: 28,859,066	N291K	probably damaging	Het
Dennd1a	T	G	2: 37,852,434	M3L	probably benign	Het
Dnah12	C	T	14: 26,766,190	P1017L	probably damaging	Het
Dnajc6	A	T	4: 101,599,167	D86V	probably damaging	Het
Evx2	T	G	2: 74,657,851	K208N	probably damaging	Het
F13a1	A	G	13: 36,868,811	V718A	probably damaging	Het
Fcho2	T	C	13: 98,726,198	D757G	probably benign	Het
Fmnl2	A	G	2: 53,105,537	E424G	probably damaging	Het
Fryl	C	T	5: 73,074,751	W424*	probably null	Het
Gata3	G	T	2: 9,874,768	Y97*	probably null	Het
Gm15446	T	A	5: 109,942,457	C192S	probably damaging	Het
Hdac10	A	T	15: 89,125,318	D470E	probably benign	Het
Ier2	A	G	8: 84,662,426	L109P	probably benign	Het
Kcnh2	T	C	5: 24,322,219	T559A	probably benign	Het
Khk	C	T	5: 30,930,594	A204V	probably damaging	Het
Kndc1	T	A	7: 139,927,408	M1169K	possibly damaging	Het
Krtap31-1	A	G	11: 99,908,093	S41G	probably benign	Het
Nabp1	T	C	1: 51,473,003		probably null	Het
Olfr513	A	T	7: 108,755,102	N82I	probably damaging	Het
Plcg2	T	C	8: 117,614,235	I1089T	possibly damaging	Het
Ptk2	A	T	15: 73,262,575	D558E	probably damaging	Het
Serpinb6d	A	G	13: 33,669,129	D168G	probably benign	Het
Shisa8	G	A	15: 82,208,555	P189L	probably damaging	Het
Shkbp1	A	G	7: 27,354,779	V89A	probably benign	Het
Slc40a1	C	T	1: 45,911,297	A332T	probably damaging	Het
Slc44a3	A	T	3: 121,497,847	Y373*	probably null	Het
Slf2	T	C	19: 44,949,001	V722A	probably benign	Het
Spanxn4	A	G	12: 62,687,838		noncoding transcript	Het
Stag3	T	A	5: 138,298,639		probably null	Het
Tanc1	T	C	2: 59,797,694	I612T	possibly damaging	Het
Thbs2	T	A	17: 14,685,781	M286L	probably benign	Het
Top1	T	A	2: 160,703,595	N294K	probably benign	Het
Tpr	T	G	1: 150,426,893	L1381V	probably damaging	Het
Trpm8	T	G	1: 88,326,432	S126A	probably benign	Het
Ttc41	A	G	10: 86,775,993	Y1075C	probably damaging	Het
Ubox5	C	T	2: 130,597,456	G418D	probably benign	Het
Vmn1r67	T	C	7: 10,446,980	V57A	possibly damaging	Het
Zbtb5	T	C	4: 44,993,500	H628R	probably damaging	Het
Zfp810	T	C	9: 22,278,920	I231V	probably benign	Het

Other mutations in Nphp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01707:Nphp3	APN	9	104018158	missense	possibly damaging	0.75
IGL02329:Nphp3	APN	9	104025968	missense	probably benign	0.19
lithograph	UTSW	9	104041990	missense	probably damaging	1.00
quartzite	UTSW	9	104036177	missense	probably damaging	1.00
F5770:Nphp3	UTSW	9	104035894	critical splice donor site	probably null
FR4548:Nphp3	UTSW	9	104025939	small deletion	probably benign
FR4589:Nphp3	UTSW	9	104025939	small deletion	probably benign
R0112:Nphp3	UTSW	9	104037348	missense	possibly damaging	0.80
R0555:Nphp3	UTSW	9	104023434	missense	probably damaging	1.00
R0632:Nphp3	UTSW	9	104018274	missense	probably damaging	1.00
R0674:Nphp3	UTSW	9	104036282	critical splice donor site	probably null
R0743:Nphp3	UTSW	9	104022768	small deletion	probably benign
R0853:Nphp3	UTSW	9	104031933	missense	probably benign	0.03
R0920:Nphp3	UTSW	9	104031907	missense	probably benign	0.00
R1420:Nphp3	UTSW	9	104035893	critical splice donor site	probably null
R1464:Nphp3	UTSW	9	104031879	splice site	probably benign
R1476:Nphp3	UTSW	9	104025927	missense	possibly damaging	0.81
R1585:Nphp3	UTSW	9	104009214	missense	probably damaging	1.00
R1688:Nphp3	UTSW	9	104003124	missense	probably damaging	1.00
R1691:Nphp3	UTSW	9	104002811	missense	probably benign
R1807:Nphp3	UTSW	9	104020741	missense	probably benign	0.01
R1857:Nphp3	UTSW	9	104021294	missense	possibly damaging	0.87
R1962:Nphp3	UTSW	9	104021338	missense	probably benign	0.00
R2127:Nphp3	UTSW	9	104008243	missense	probably damaging	0.98
R2138:Nphp3	UTSW	9	104025903	missense	possibly damaging	0.89
R2233:Nphp3	UTSW	9	104037376	missense	probably benign	0.02
R2234:Nphp3	UTSW	9	104037376	missense	probably benign	0.02
R3861:Nphp3	UTSW	9	104039326	unclassified	probably benign
R3928:Nphp3	UTSW	9	104011730	missense	probably damaging	0.99
R3961:Nphp3	UTSW	9	104003042	nonsense	probably null
R4182:Nphp3	UTSW	9	104038464	missense	probably benign	0.06
R4294:Nphp3	UTSW	9	104022717	missense	probably damaging	1.00
R4387:Nphp3	UTSW	9	104030020	missense	possibly damaging	0.94
R4625:Nphp3	UTSW	9	104036159	missense	possibly damaging	0.66
R4628:Nphp3	UTSW	9	104003058	missense	probably damaging	0.99
R4696:Nphp3	UTSW	9	104022732	missense	probably benign	0.01
R4865:Nphp3	UTSW	9	104031970	missense	probably benign
R4886:Nphp3	UTSW	9	104002994	missense	probably damaging	1.00
R4973:Nphp3	UTSW	9	104031999	missense	probably benign
R5445:Nphp3	UTSW	9	104004723	missense	probably damaging	1.00
R5451:Nphp3	UTSW	9	104042022	missense	probably benign
R5520:Nphp3	UTSW	9	104024673	missense	probably benign	0.30
R5641:Nphp3	UTSW	9	104036153	missense	probably damaging	1.00
R5847:Nphp3	UTSW	9	104003037	missense	probably damaging	1.00
R5928:Nphp3	UTSW	9	104035797	missense	probably benign	0.01
R5931:Nphp3	UTSW	9	104020746	missense	probably damaging	1.00
R6161:Nphp3	UTSW	9	104031906	missense	probably benign	0.11
R6298:Nphp3	UTSW	9	104015441	missense	probably damaging	1.00
R6890:Nphp3	UTSW	9	104041954	missense	probably damaging	0.96
R7009:Nphp3	UTSW	9	104016116	missense	probably null	0.00
R7065:Nphp3	UTSW	9	104041990	missense	probably damaging	1.00
R7146:Nphp3	UTSW	9	104004837	nonsense	probably null
R7198:Nphp3	UTSW	9	104004775	missense	probably damaging	1.00
R7360:Nphp3	UTSW	9	104016078	critical splice acceptor site	probably null
R7369:Nphp3	UTSW	9	104018250	missense	probably damaging	0.99
R7554:Nphp3	UTSW	9	104042071	missense	probably damaging	0.98
R7591:Nphp3	UTSW	9	104018278	critical splice donor site	probably null
R7665:Nphp3	UTSW	9	104005393	splice site	probably null
R7672:Nphp3	UTSW	9	104031960	missense	probably benign
R7675:Nphp3	UTSW	9	104016088	missense	probably benign
R8039:Nphp3	UTSW	9	104031963	missense	probably benign
R8145:Nphp3	UTSW	9	104035851	missense	probably benign	0.16
R8211:Nphp3	UTSW	9	104031897	missense	possibly damaging	0.80
R8882:Nphp3	UTSW	9	104005594	missense	possibly damaging	0.77
R9020:Nphp3	UTSW	9	104031951	missense	probably benign	0.00
R9132:Nphp3	UTSW	9	104020781	missense	probably damaging	1.00
R9135:Nphp3	UTSW	9	104032015	missense	probably damaging	0.99
R9159:Nphp3	UTSW	9	104020781	missense	probably damaging	1.00
R9204:Nphp3	UTSW	9	104042106	missense	probably benign
R9226:Nphp3	UTSW	9	104008129	missense	probably benign	0.00
R9229:Nphp3	UTSW	9	104036177	missense	probably damaging	1.00
R9526:Nphp3	UTSW	9	104036138	missense	probably damaging	1.00
R9678:Nphp3	UTSW	9	104023487	missense	possibly damaging	0.90
R9731:Nphp3	UTSW	9	104009170	missense	probably damaging	1.00
V7583:Nphp3	UTSW	9	104035894	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AACTGCCTACAGCTCCGTAGGAAG -3'
(R):5'- TTCTAGGGACCTCTGCAAAGGCAC -3'

Sequencing Primer
(F):5'- AATTCTGACGTTTTCATTTGCTG -3'
(R):5'- TCTGCAAAGGCACCACGG -3'

Posted On

2014-04-24