Mutagenetix > Incidental Mutation

Incidental Mutation 'R1608:Serpinb6d'

176642

Institutional Source

Beutler Lab

Gene Symbol

Serpinb6d

Ensembl Gene

ENSMUSG00000047889

Gene Name

serine (or cysteine) peptidase inhibitor, clade B, member 6d

Synonyms

SPI3D, Gm11390

MMRRC Submission

039645-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.120) question?

Stock #

R1608 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

33661405-33671581 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 33669129 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 168 (D168G)

Ref Sequence

ENSEMBL: ENSMUSP00000152621 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059637] [ENSMUST00000221681]

AlphaFold

Q3UWK8

Predicted Effect

probably benign
Transcript: ENSMUST00000059637
AA Change: D168G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000063025
Gene: ENSMUSG00000047889
AA Change: D168G

Domain	Start	End	E-Value	Type
SERPIN	13	375	1.67e-144	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000221681
AA Change: D168G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 89.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene is a member of the large Serpin gene family. Many members of this family act as protease inhibitors, and have a conserved structure including a reactive center loop (RCL) that can act as a bait for protease targets. Unlike some members of this large gene family, the protein encoded by this gene is an intracellular protein, and lacks an N-terminal signal peptide sequence. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 13. [provided by RefSeq, Jul 2014]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts15	A	G	9: 30,902,479	S797P	probably damaging	Het
Akap9	T	C	5: 3,961,783	Y829H	probably damaging	Het
Anp32a	A	G	9: 62,372,093	D74G	probably damaging	Het
B230118H07Rik	T	C	2: 101,610,571	E29G	probably damaging	Het
B3gat1	T	C	9: 26,751,816	I13T	probably damaging	Het
Cbfa2t3	A	T	8: 122,647,709	V99D	probably damaging	Het
Celsr2	C	T	3: 108,402,483	C1600Y	probably damaging	Het
Ddx31	T	A	2: 28,859,066	N291K	probably damaging	Het
Dennd1a	T	G	2: 37,852,434	M3L	probably benign	Het
Dnah12	C	T	14: 26,766,190	P1017L	probably damaging	Het
Dnajc6	A	T	4: 101,599,167	D86V	probably damaging	Het
Evx2	T	G	2: 74,657,851	K208N	probably damaging	Het
F13a1	A	G	13: 36,868,811	V718A	probably damaging	Het
Fcho2	T	C	13: 98,726,198	D757G	probably benign	Het
Fmnl2	A	G	2: 53,105,537	E424G	probably damaging	Het
Fryl	C	T	5: 73,074,751	W424*	probably null	Het
Gata3	G	T	2: 9,874,768	Y97*	probably null	Het
Gm15446	T	A	5: 109,942,457	C192S	probably damaging	Het
Hdac10	A	T	15: 89,125,318	D470E	probably benign	Het
Ier2	A	G	8: 84,662,426	L109P	probably benign	Het
Kcnh2	T	C	5: 24,322,219	T559A	probably benign	Het
Khk	C	T	5: 30,930,594	A204V	probably damaging	Het
Kndc1	T	A	7: 139,927,408	M1169K	possibly damaging	Het
Krtap31-1	A	G	11: 99,908,093	S41G	probably benign	Het
Nabp1	T	C	1: 51,473,003		probably null	Het
Nphp3	A	G	9: 104,035,840	D939G	probably benign	Het
Olfr513	A	T	7: 108,755,102	N82I	probably damaging	Het
Plcg2	T	C	8: 117,614,235	I1089T	possibly damaging	Het
Ptk2	A	T	15: 73,262,575	D558E	probably damaging	Het
Shisa8	G	A	15: 82,208,555	P189L	probably damaging	Het
Shkbp1	A	G	7: 27,354,779	V89A	probably benign	Het
Slc40a1	C	T	1: 45,911,297	A332T	probably damaging	Het
Slc44a3	A	T	3: 121,497,847	Y373*	probably null	Het
Slf2	T	C	19: 44,949,001	V722A	probably benign	Het
Spanxn4	A	G	12: 62,687,838		noncoding transcript	Het
Stag3	T	A	5: 138,298,639		probably null	Het
Tanc1	T	C	2: 59,797,694	I612T	possibly damaging	Het
Thbs2	T	A	17: 14,685,781	M286L	probably benign	Het
Top1	T	A	2: 160,703,595	N294K	probably benign	Het
Tpr	T	G	1: 150,426,893	L1381V	probably damaging	Het
Trpm8	T	G	1: 88,326,432	S126A	probably benign	Het
Ttc41	A	G	10: 86,775,993	Y1075C	probably damaging	Het
Ubox5	C	T	2: 130,597,456	G418D	probably benign	Het
Vmn1r67	T	C	7: 10,446,980	V57A	possibly damaging	Het
Zbtb5	T	C	4: 44,993,500	H628R	probably damaging	Het
Zfp810	T	C	9: 22,278,920	I231V	probably benign	Het

Other mutations in Serpinb6d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01482:Serpinb6d	APN	13	33671363	missense	probably benign	0.05
IGL01611:Serpinb6d	APN	13	33666392	nonsense	probably null
IGL01946:Serpinb6d	APN	13	33671386	missense	probably benign	0.22
IGL02672:Serpinb6d	APN	13	33671389	missense	probably benign	0.36
R0041:Serpinb6d	UTSW	13	33667632	missense	probably damaging	0.98
R0041:Serpinb6d	UTSW	13	33667632	missense	probably damaging	0.98
R1112:Serpinb6d	UTSW	13	33669135	missense	probably damaging	1.00
R1159:Serpinb6d	UTSW	13	33671229	missense	probably damaging	0.98
R1447:Serpinb6d	UTSW	13	33670756	missense	probably benign	0.42
R1843:Serpinb6d	UTSW	13	33671381	missense	probably benign
R1945:Serpinb6d	UTSW	13	33667680	missense	possibly damaging	0.95
R2168:Serpinb6d	UTSW	13	33666374	missense	probably benign	0.08
R2275:Serpinb6d	UTSW	13	33671428	missense	probably benign	0.00
R3737:Serpinb6d	UTSW	13	33667680	missense	probably damaging	1.00
R3738:Serpinb6d	UTSW	13	33667680	missense	probably damaging	1.00
R3739:Serpinb6d	UTSW	13	33667680	missense	probably damaging	1.00
R3780:Serpinb6d	UTSW	13	33664114	missense	probably benign
R3782:Serpinb6d	UTSW	13	33664114	missense	probably benign
R4002:Serpinb6d	UTSW	13	33670647	missense	probably damaging	0.98
R4685:Serpinb6d	UTSW	13	33671228	missense	probably damaging	1.00
R4707:Serpinb6d	UTSW	13	33671353	missense	possibly damaging	0.83
R4761:Serpinb6d	UTSW	13	33671267	missense	probably damaging	1.00
R4859:Serpinb6d	UTSW	13	33667564	splice site	probably null
R4884:Serpinb6d	UTSW	13	33666445	missense	possibly damaging	0.76
R4951:Serpinb6d	UTSW	13	33666383	missense	probably benign	0.03
R5010:Serpinb6d	UTSW	13	33671444	missense	probably benign	0.15
R5081:Serpinb6d	UTSW	13	33671247	missense	probably benign	0.32
R6726:Serpinb6d	UTSW	13	33670735	missense	probably benign	0.01
R6960:Serpinb6d	UTSW	13	33671198	missense	probably benign	0.08
R7214:Serpinb6d	UTSW	13	33664145	missense	probably damaging	1.00
R7732:Serpinb6d	UTSW	13	33669099	missense	probably benign	0.14
R8128:Serpinb6d	UTSW	13	33666400	missense	possibly damaging	0.46
R8197:Serpinb6d	UTSW	13	33667605	missense	probably damaging	0.98
R8471:Serpinb6d	UTSW	13	33664154	missense	probably damaging	0.99
R9026:Serpinb6d	UTSW	13	33667673	missense	possibly damaging	0.51
R9080:Serpinb6d	UTSW	13	33671124	missense	probably benign
R9253:Serpinb6d	UTSW	13	33671222	missense	probably damaging	1.00
R9562:Serpinb6d	UTSW	13	33670773	missense	probably benign	0.00
Z1088:Serpinb6d	UTSW	13	33671254	missense	possibly damaging	0.79

Predicted Primers

PCR Primer
(F):5'- CAGGATGTTGCACAACTTGCTGATG -3'
(R):5'- CCGCAAGGAGACTCTTTATAGAAGCC -3'

Sequencing Primer
(F):5'- tccacccccaacaatacac -3'
(R):5'- GAGACTCTTTATAGAAGCCAGTGTG -3'

Posted On

2014-04-24