Incidental Mutation 'R1608:Serpinb6d'
ID 176642
Institutional Source Beutler Lab
Gene Symbol Serpinb6d
Ensembl Gene ENSMUSG00000047889
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 6d
Synonyms SPI3D, Gm11390
MMRRC Submission 039645-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.120) question?
Stock # R1608 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 33661405-33671581 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 33669129 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 168 (D168G)
Ref Sequence ENSEMBL: ENSMUSP00000152621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059637] [ENSMUST00000221681]
AlphaFold Q3UWK8
Predicted Effect probably benign
Transcript: ENSMUST00000059637
AA Change: D168G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000063025
Gene: ENSMUSG00000047889
AA Change: D168G

DomainStartEndE-ValueType
SERPIN 13 375 1.67e-144 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221681
AA Change: D168G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is a member of the large Serpin gene family. Many members of this family act as protease inhibitors, and have a conserved structure including a reactive center loop (RCL) that can act as a bait for protease targets. Unlike some members of this large gene family, the protein encoded by this gene is an intracellular protein, and lacks an N-terminal signal peptide sequence. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 13. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 A G 9: 30,902,479 S797P probably damaging Het
Akap9 T C 5: 3,961,783 Y829H probably damaging Het
Anp32a A G 9: 62,372,093 D74G probably damaging Het
B230118H07Rik T C 2: 101,610,571 E29G probably damaging Het
B3gat1 T C 9: 26,751,816 I13T probably damaging Het
Cbfa2t3 A T 8: 122,647,709 V99D probably damaging Het
Celsr2 C T 3: 108,402,483 C1600Y probably damaging Het
Ddx31 T A 2: 28,859,066 N291K probably damaging Het
Dennd1a T G 2: 37,852,434 M3L probably benign Het
Dnah12 C T 14: 26,766,190 P1017L probably damaging Het
Dnajc6 A T 4: 101,599,167 D86V probably damaging Het
Evx2 T G 2: 74,657,851 K208N probably damaging Het
F13a1 A G 13: 36,868,811 V718A probably damaging Het
Fcho2 T C 13: 98,726,198 D757G probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Fryl C T 5: 73,074,751 W424* probably null Het
Gata3 G T 2: 9,874,768 Y97* probably null Het
Gm15446 T A 5: 109,942,457 C192S probably damaging Het
Hdac10 A T 15: 89,125,318 D470E probably benign Het
Ier2 A G 8: 84,662,426 L109P probably benign Het
Kcnh2 T C 5: 24,322,219 T559A probably benign Het
Khk C T 5: 30,930,594 A204V probably damaging Het
Kndc1 T A 7: 139,927,408 M1169K possibly damaging Het
Krtap31-1 A G 11: 99,908,093 S41G probably benign Het
Nabp1 T C 1: 51,473,003 probably null Het
Nphp3 A G 9: 104,035,840 D939G probably benign Het
Olfr513 A T 7: 108,755,102 N82I probably damaging Het
Plcg2 T C 8: 117,614,235 I1089T possibly damaging Het
Ptk2 A T 15: 73,262,575 D558E probably damaging Het
Shisa8 G A 15: 82,208,555 P189L probably damaging Het
Shkbp1 A G 7: 27,354,779 V89A probably benign Het
Slc40a1 C T 1: 45,911,297 A332T probably damaging Het
Slc44a3 A T 3: 121,497,847 Y373* probably null Het
Slf2 T C 19: 44,949,001 V722A probably benign Het
Spanxn4 A G 12: 62,687,838 noncoding transcript Het
Stag3 T A 5: 138,298,639 probably null Het
Tanc1 T C 2: 59,797,694 I612T possibly damaging Het
Thbs2 T A 17: 14,685,781 M286L probably benign Het
Top1 T A 2: 160,703,595 N294K probably benign Het
Tpr T G 1: 150,426,893 L1381V probably damaging Het
Trpm8 T G 1: 88,326,432 S126A probably benign Het
Ttc41 A G 10: 86,775,993 Y1075C probably damaging Het
Ubox5 C T 2: 130,597,456 G418D probably benign Het
Vmn1r67 T C 7: 10,446,980 V57A possibly damaging Het
Zbtb5 T C 4: 44,993,500 H628R probably damaging Het
Zfp810 T C 9: 22,278,920 I231V probably benign Het
Other mutations in Serpinb6d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01482:Serpinb6d APN 13 33671363 missense probably benign 0.05
IGL01611:Serpinb6d APN 13 33666392 nonsense probably null
IGL01946:Serpinb6d APN 13 33671386 missense probably benign 0.22
IGL02672:Serpinb6d APN 13 33671389 missense probably benign 0.36
R0041:Serpinb6d UTSW 13 33667632 missense probably damaging 0.98
R0041:Serpinb6d UTSW 13 33667632 missense probably damaging 0.98
R1112:Serpinb6d UTSW 13 33669135 missense probably damaging 1.00
R1159:Serpinb6d UTSW 13 33671229 missense probably damaging 0.98
R1447:Serpinb6d UTSW 13 33670756 missense probably benign 0.42
R1843:Serpinb6d UTSW 13 33671381 missense probably benign
R1945:Serpinb6d UTSW 13 33667680 missense possibly damaging 0.95
R2168:Serpinb6d UTSW 13 33666374 missense probably benign 0.08
R2275:Serpinb6d UTSW 13 33671428 missense probably benign 0.00
R3737:Serpinb6d UTSW 13 33667680 missense probably damaging 1.00
R3738:Serpinb6d UTSW 13 33667680 missense probably damaging 1.00
R3739:Serpinb6d UTSW 13 33667680 missense probably damaging 1.00
R3780:Serpinb6d UTSW 13 33664114 missense probably benign
R3782:Serpinb6d UTSW 13 33664114 missense probably benign
R4002:Serpinb6d UTSW 13 33670647 missense probably damaging 0.98
R4685:Serpinb6d UTSW 13 33671228 missense probably damaging 1.00
R4707:Serpinb6d UTSW 13 33671353 missense possibly damaging 0.83
R4761:Serpinb6d UTSW 13 33671267 missense probably damaging 1.00
R4859:Serpinb6d UTSW 13 33667564 splice site probably null
R4884:Serpinb6d UTSW 13 33666445 missense possibly damaging 0.76
R4951:Serpinb6d UTSW 13 33666383 missense probably benign 0.03
R5010:Serpinb6d UTSW 13 33671444 missense probably benign 0.15
R5081:Serpinb6d UTSW 13 33671247 missense probably benign 0.32
R6726:Serpinb6d UTSW 13 33670735 missense probably benign 0.01
R6960:Serpinb6d UTSW 13 33671198 missense probably benign 0.08
R7214:Serpinb6d UTSW 13 33664145 missense probably damaging 1.00
R7732:Serpinb6d UTSW 13 33669099 missense probably benign 0.14
R8128:Serpinb6d UTSW 13 33666400 missense possibly damaging 0.46
R8197:Serpinb6d UTSW 13 33667605 missense probably damaging 0.98
R8471:Serpinb6d UTSW 13 33664154 missense probably damaging 0.99
R9026:Serpinb6d UTSW 13 33667673 missense possibly damaging 0.51
R9080:Serpinb6d UTSW 13 33671124 missense probably benign
R9253:Serpinb6d UTSW 13 33671222 missense probably damaging 1.00
R9562:Serpinb6d UTSW 13 33670773 missense probably benign 0.00
Z1088:Serpinb6d UTSW 13 33671254 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CAGGATGTTGCACAACTTGCTGATG -3'
(R):5'- CCGCAAGGAGACTCTTTATAGAAGCC -3'

Sequencing Primer
(F):5'- tccacccccaacaatacac -3'
(R):5'- GAGACTCTTTATAGAAGCCAGTGTG -3'
Posted On 2014-04-24