Incidental Mutation 'R1608:Shisa8'
ID176648
Institutional Source Beutler Lab
Gene Symbol Shisa8
Ensembl Gene ENSMUSG00000096883
Gene Nameshisa family member 8
SynonymsAI848285, Orf26
MMRRC Submission 039645-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1608 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location82206168-82212815 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 82208555 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 189 (P189L)
Ref Sequence ENSEMBL: ENSMUSP00000137002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023100] [ENSMUST00000179269] [ENSMUST00000229336] [ENSMUST00000229543]
Predicted Effect probably benign
Transcript: ENSMUST00000023100
SMART Domains Protein: ENSMUSP00000023100
Gene: ENSMUSG00000022463

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 56 75 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
low complexity region 118 137 N/A INTRINSIC
low complexity region 178 204 N/A INTRINSIC
low complexity region 210 235 N/A INTRINSIC
HLH 325 375 3.54e-15 SMART
low complexity region 383 394 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 570 586 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179269
AA Change: P189L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137002
Gene: ENSMUSG00000096883
AA Change: P189L

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Pfam:Shisa 55 189 1.7e-33 PFAM
low complexity region 234 246 N/A INTRINSIC
low complexity region 255 268 N/A INTRINSIC
low complexity region 310 328 N/A INTRINSIC
low complexity region 349 360 N/A INTRINSIC
low complexity region 370 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229336
Predicted Effect probably damaging
Transcript: ENSMUST00000229543
AA Change: P45L

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000230955
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 A G 9: 30,902,479 S797P probably damaging Het
Akap9 T C 5: 3,961,783 Y829H probably damaging Het
Anp32a A G 9: 62,372,093 D74G probably damaging Het
B230118H07Rik T C 2: 101,610,571 E29G probably damaging Het
B3gat1 T C 9: 26,751,816 I13T probably damaging Het
Cbfa2t3 A T 8: 122,647,709 V99D probably damaging Het
Celsr2 C T 3: 108,402,483 C1600Y probably damaging Het
Ddx31 T A 2: 28,859,066 N291K probably damaging Het
Dennd1a T G 2: 37,852,434 M3L probably benign Het
Dnah12 C T 14: 26,766,190 P1017L probably damaging Het
Dnajc6 A T 4: 101,599,167 D86V probably damaging Het
Evx2 T G 2: 74,657,851 K208N probably damaging Het
F13a1 A G 13: 36,868,811 V718A probably damaging Het
Fcho2 T C 13: 98,726,198 D757G probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Fryl C T 5: 73,074,751 W424* probably null Het
Gata3 G T 2: 9,874,768 Y97* probably null Het
Gm15446 T A 5: 109,942,457 C192S probably damaging Het
Hdac10 A T 15: 89,125,318 D470E probably benign Het
Ier2 A G 8: 84,662,426 L109P probably benign Het
Kcnh2 T C 5: 24,322,219 T559A probably benign Het
Khk C T 5: 30,930,594 A204V probably damaging Het
Kndc1 T A 7: 139,927,408 M1169K possibly damaging Het
Krtap31-1 A G 11: 99,908,093 S41G probably benign Het
Nabp1 T C 1: 51,473,003 probably null Het
Nphp3 A G 9: 104,035,840 D939G probably benign Het
Olfr513 A T 7: 108,755,102 N82I probably damaging Het
Plcg2 T C 8: 117,614,235 I1089T possibly damaging Het
Ptk2 A T 15: 73,262,575 D558E probably damaging Het
Serpinb6d A G 13: 33,669,129 D168G probably benign Het
Shkbp1 A G 7: 27,354,779 V89A probably benign Het
Slc40a1 C T 1: 45,911,297 A332T probably damaging Het
Slc44a3 A T 3: 121,497,847 Y373* probably null Het
Slf2 T C 19: 44,949,001 V722A probably benign Het
Spanxn4 A G 12: 62,687,838 noncoding transcript Het
Stag3 T A 5: 138,298,639 probably null Het
Tanc1 T C 2: 59,797,694 I612T possibly damaging Het
Thbs2 T A 17: 14,685,781 M286L probably benign Het
Top1 T A 2: 160,703,595 N294K probably benign Het
Tpr T G 1: 150,426,893 L1381V probably damaging Het
Trpm8 T G 1: 88,326,432 S126A probably benign Het
Ttc41 A G 10: 86,775,993 Y1075C probably damaging Het
Ubox5 C T 2: 130,597,456 G418D probably benign Het
Vmn1r67 T C 7: 10,446,980 V57A possibly damaging Het
Zbtb5 T C 4: 44,993,500 H628R probably damaging Het
Zfp810 T C 9: 22,278,920 I231V probably benign Het
Other mutations in Shisa8
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1522:Shisa8 UTSW 15 82208501 missense probably damaging 0.98
R4520:Shisa8 UTSW 15 82211962 missense possibly damaging 0.84
R4524:Shisa8 UTSW 15 82211962 missense possibly damaging 0.84
R6844:Shisa8 UTSW 15 82212109 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCACGGGCAGCCACTCATTT -3'
(R):5'- GGACATAGCGGTTAAGAATACTAGCAGC -3'

Sequencing Primer
(F):5'- ATGAAATGTAGCTGTTCCACTCTC -3'
(R):5'- tggagatggggagagtcaag -3'
Posted On2014-04-24