Mutagenetix > Incidental Mutation

Incidental Mutation 'R1608:Thbs2'

176650

Institutional Source

Beutler Lab

Gene Symbol

Thbs2

Ensembl Gene

ENSMUSG00000023885

Gene Name

thrombospondin 2

Synonyms

Thbs-2, Thrombospondin-2, TSP2

MMRRC Submission

039645-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.301) question?

Stock #

R1608 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

14665500-14694235 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 14685781 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 286 (M286L)

Ref Sequence

ENSEMBL: ENSMUSP00000128308 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170872]

AlphaFold

Q03350

Predicted Effect

probably benign
Transcript: ENSMUST00000170872
AA Change: M286L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000128308
Gene: ENSMUSG00000023885
AA Change: M286L

Domain	Start	End	E-Value	Type
low complexity region	2	10	N/A	INTRINSIC
TSPN	21	215	3.8e-60	SMART
VWC	320	374	3.55e-19	SMART
TSP1	384	431	3.36e-11	SMART
TSP1	440	492	1.35e-15	SMART
TSP1	497	549	8.6e-18	SMART
EGF	552	589	6.3e-3	SMART
EGF	593	647	1.56e1	SMART
EGF	651	692	2.19e-2	SMART
Pfam:TSP_3	729	764	2.5e-12	PFAM
Pfam:TSP_3	763	787	7.4e-7	PFAM
Pfam:TSP_3	788	823	9.4e-12	PFAM
Pfam:TSP_3	823	846	4.1e-7	PFAM
Pfam:TSP_3	847	884	1.7e-12	PFAM
Pfam:TSP_3	885	920	1.3e-11	PFAM
Pfam:TSP_3	921	956	3.1e-11	PFAM
Pfam:TSP_C	974	1171	1e-98	PFAM

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 89.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin family. It is a disulfide-linked homotrimeric glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein has been shown to function as a potent inhibitor of tumor growth and angiogenesis. Studies of the mouse counterpart suggest that this protein may modulate the cell surface properties of mesenchymal cells and be involved in cell adhesion and migration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display premature death, abnormal tails, marked structural and functional abnormalities in a variety of connective tissues including skin, tendon, bone, and blood vessels, accelerated wound healing, and enhanced susceptibility to experimental skin tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts15	A	G	9: 30,902,479	S797P	probably damaging	Het
Akap9	T	C	5: 3,961,783	Y829H	probably damaging	Het
Anp32a	A	G	9: 62,372,093	D74G	probably damaging	Het
B230118H07Rik	T	C	2: 101,610,571	E29G	probably damaging	Het
B3gat1	T	C	9: 26,751,816	I13T	probably damaging	Het
Cbfa2t3	A	T	8: 122,647,709	V99D	probably damaging	Het
Celsr2	C	T	3: 108,402,483	C1600Y	probably damaging	Het
Ddx31	T	A	2: 28,859,066	N291K	probably damaging	Het
Dennd1a	T	G	2: 37,852,434	M3L	probably benign	Het
Dnah12	C	T	14: 26,766,190	P1017L	probably damaging	Het
Dnajc6	A	T	4: 101,599,167	D86V	probably damaging	Het
Evx2	T	G	2: 74,657,851	K208N	probably damaging	Het
F13a1	A	G	13: 36,868,811	V718A	probably damaging	Het
Fcho2	T	C	13: 98,726,198	D757G	probably benign	Het
Fmnl2	A	G	2: 53,105,537	E424G	probably damaging	Het
Fryl	C	T	5: 73,074,751	W424*	probably null	Het
Gata3	G	T	2: 9,874,768	Y97*	probably null	Het
Gm15446	T	A	5: 109,942,457	C192S	probably damaging	Het
Hdac10	A	T	15: 89,125,318	D470E	probably benign	Het
Ier2	A	G	8: 84,662,426	L109P	probably benign	Het
Kcnh2	T	C	5: 24,322,219	T559A	probably benign	Het
Khk	C	T	5: 30,930,594	A204V	probably damaging	Het
Kndc1	T	A	7: 139,927,408	M1169K	possibly damaging	Het
Krtap31-1	A	G	11: 99,908,093	S41G	probably benign	Het
Nabp1	T	C	1: 51,473,003		probably null	Het
Nphp3	A	G	9: 104,035,840	D939G	probably benign	Het
Olfr513	A	T	7: 108,755,102	N82I	probably damaging	Het
Plcg2	T	C	8: 117,614,235	I1089T	possibly damaging	Het
Ptk2	A	T	15: 73,262,575	D558E	probably damaging	Het
Serpinb6d	A	G	13: 33,669,129	D168G	probably benign	Het
Shisa8	G	A	15: 82,208,555	P189L	probably damaging	Het
Shkbp1	A	G	7: 27,354,779	V89A	probably benign	Het
Slc40a1	C	T	1: 45,911,297	A332T	probably damaging	Het
Slc44a3	A	T	3: 121,497,847	Y373*	probably null	Het
Slf2	T	C	19: 44,949,001	V722A	probably benign	Het
Spanxn4	A	G	12: 62,687,838		noncoding transcript	Het
Stag3	T	A	5: 138,298,639		probably null	Het
Tanc1	T	C	2: 59,797,694	I612T	possibly damaging	Het
Top1	T	A	2: 160,703,595	N294K	probably benign	Het
Tpr	T	G	1: 150,426,893	L1381V	probably damaging	Het
Trpm8	T	G	1: 88,326,432	S126A	probably benign	Het
Ttc41	A	G	10: 86,775,993	Y1075C	probably damaging	Het
Ubox5	C	T	2: 130,597,456	G418D	probably benign	Het
Vmn1r67	T	C	7: 10,446,980	V57A	possibly damaging	Het
Zbtb5	T	C	4: 44,993,500	H628R	probably damaging	Het
Zfp810	T	C	9: 22,278,920	I231V	probably benign	Het

Other mutations in Thbs2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Thbs2	APN	17	14668835	missense	probably damaging	1.00
IGL00764:Thbs2	APN	17	14690252	missense	probably damaging	0.98
IGL01370:Thbs2	APN	17	14690065	missense	possibly damaging	0.82
IGL01604:Thbs2	APN	17	14678769	missense	probably benign	0.31
IGL01936:Thbs2	APN	17	14687814	missense	probably benign	0.00
IGL02061:Thbs2	APN	17	14679914	missense	probably benign	0.35
IGL02255:Thbs2	APN	17	14689785	missense	probably benign	0.00
IGL02342:Thbs2	APN	17	14676316	missense	probably damaging	1.00
IGL02402:Thbs2	APN	17	14671454	missense	probably benign	0.01
IGL02499:Thbs2	APN	17	14684066	splice site	probably benign
IGL02572:Thbs2	APN	17	14677013	missense	possibly damaging	0.72
IGL02701:Thbs2	APN	17	14683361	missense	probably benign	0.05
IGL02871:Thbs2	APN	17	14685786	missense	probably benign
IGL03058:Thbs2	APN	17	14689969	missense	possibly damaging	0.91
IGL03185:Thbs2	APN	17	14681410	nonsense	probably null
IGL03232:Thbs2	APN	17	14691413	start codon destroyed	probably null
IGL03289:Thbs2	APN	17	14690122	missense	probably benign	0.00
IGL03407:Thbs2	APN	17	14673273	missense	probably benign	0.00
H8562:Thbs2	UTSW	17	14671453	missense	probably benign	0.00
IGL02802:Thbs2	UTSW	17	14684127	missense	probably benign	0.01
PIT4354001:Thbs2	UTSW	17	14689968	missense	probably damaging	0.99
R0088:Thbs2	UTSW	17	14681701	missense	possibly damaging	0.96
R0167:Thbs2	UTSW	17	14667525	splice site	probably benign
R0415:Thbs2	UTSW	17	14679973	missense	probably benign
R0658:Thbs2	UTSW	17	14680325	missense	probably benign	0.00
R0735:Thbs2	UTSW	17	14679815	missense	probably benign	0.00
R1582:Thbs2	UTSW	17	14671288	missense	probably damaging	1.00
R1585:Thbs2	UTSW	17	14689768	missense	probably benign	0.00
R1721:Thbs2	UTSW	17	14678810	missense	probably benign	0.00
R1724:Thbs2	UTSW	17	14685900	missense	possibly damaging	0.80
R1791:Thbs2	UTSW	17	14685813	missense	probably benign
R1816:Thbs2	UTSW	17	14670713	missense	probably benign	0.01
R1816:Thbs2	UTSW	17	14670714	missense	probably benign	0.00
R1911:Thbs2	UTSW	17	14689842	missense	probably benign	0.38
R2137:Thbs2	UTSW	17	14673306	missense	probably damaging	1.00
R2152:Thbs2	UTSW	17	14673209	missense	probably damaging	1.00
R2244:Thbs2	UTSW	17	14671413	missense	probably damaging	1.00
R2325:Thbs2	UTSW	17	14690289	splice site	probably null
R2509:Thbs2	UTSW	17	14685843	missense	probably benign	0.11
R3838:Thbs2	UTSW	17	14687851	missense	probably benign
R4173:Thbs2	UTSW	17	14681631	splice site	probably null
R4427:Thbs2	UTSW	17	14680335	missense	probably benign
R4495:Thbs2	UTSW	17	14671413	missense	probably damaging	1.00
R4789:Thbs2	UTSW	17	14671488	missense	probably damaging	1.00
R4928:Thbs2	UTSW	17	14678900	missense	probably damaging	1.00
R5058:Thbs2	UTSW	17	14676329	missense	probably damaging	1.00
R5112:Thbs2	UTSW	17	14670590	splice site	probably null
R5619:Thbs2	UTSW	17	14681244	missense	probably damaging	1.00
R5649:Thbs2	UTSW	17	14689953	missense	probably damaging	1.00
R5664:Thbs2	UTSW	17	14689837	missense	probably damaging	1.00
R5801:Thbs2	UTSW	17	14687863	missense	probably damaging	1.00
R5816:Thbs2	UTSW	17	14684071	critical splice donor site	probably null
R5840:Thbs2	UTSW	17	14681430	splice site	probably null
R6149:Thbs2	UTSW	17	14679680	critical splice donor site	probably null
R6166:Thbs2	UTSW	17	14680388	missense	probably damaging	1.00
R6412:Thbs2	UTSW	17	14677077	missense	probably damaging	1.00
R6473:Thbs2	UTSW	17	14685796	missense	probably benign	0.23
R6640:Thbs2	UTSW	17	14673368	missense	possibly damaging	0.94
R6695:Thbs2	UTSW	17	14674164	missense	possibly damaging	0.54
R6711:Thbs2	UTSW	17	14690265	missense	probably benign	0.00
R6947:Thbs2	UTSW	17	14689767	missense	possibly damaging	0.79
R6962:Thbs2	UTSW	17	14681820	missense	probably benign	0.00
R7183:Thbs2	UTSW	17	14690116	missense	possibly damaging	0.90
R7203:Thbs2	UTSW	17	14671458	missense	probably damaging	1.00
R7386:Thbs2	UTSW	17	14673150	missense	possibly damaging	0.95
R7621:Thbs2	UTSW	17	14674164	missense	probably benign
R7747:Thbs2	UTSW	17	14670039	missense	possibly damaging	0.94
R7759:Thbs2	UTSW	17	14677059	missense	probably damaging	1.00
R7800:Thbs2	UTSW	17	14676296	missense	probably damaging	1.00
R7895:Thbs2	UTSW	17	14676221	missense	probably damaging	1.00
R8094:Thbs2	UTSW	17	14680322	missense	probably benign	0.00
R8332:Thbs2	UTSW	17	14679770	missense	probably damaging	1.00
R8478:Thbs2	UTSW	17	14680404	missense	probably benign	0.00
R8695:Thbs2	UTSW	17	14679701	missense	probably benign
R8707:Thbs2	UTSW	17	14691383	missense	probably damaging	1.00
R9001:Thbs2	UTSW	17	14668745	missense	probably damaging	1.00
R9075:Thbs2	UTSW	17	14680325	missense	probably benign	0.00
R9183:Thbs2	UTSW	17	14676264	missense	probably benign	0.03
R9461:Thbs2	UTSW	17	14690173	missense	probably damaging	1.00
R9462:Thbs2	UTSW	17	14669981	missense	probably damaging	1.00
R9536:Thbs2	UTSW	17	14689885	missense	probably damaging	1.00
R9592:Thbs2	UTSW	17	14678821	missense	probably damaging	1.00
S24628:Thbs2	UTSW	17	14679973	missense	probably benign
X0025:Thbs2	UTSW	17	14681800	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GCAATGAAGTATTGGTCCCCAGAGG -3'
(R):5'- TGCCAGCTTACAGTTGCAAGCC -3'

Sequencing Primer
(F):5'- GCCTGACTGGCTGTCTG -3'
(R):5'- AGAGACTGTGCTCCGCTATAATTC -3'

Posted On

2014-04-24