Mutagenetix > Incidental Mutation

Incidental Mutation 'R1608:Slf2'

176652

Institutional Source

Beutler Lab

Gene Symbol

Slf2

Ensembl Gene

ENSMUSG00000036097

Gene Name

SMC5-SMC6 complex localization factor 2

Synonyms

Fam178a, 6030443O07Rik

MMRRC Submission

039645-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.908) question?

Stock #

R1608 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

44931119-44983787 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 44949001 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 722 (V722A)

Ref Sequence

ENSEMBL: ENSMUSP00000093758 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096053]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083225

Predicted Effect

probably benign
Transcript: ENSMUST00000096053
AA Change: V722A

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000093758
Gene: ENSMUSG00000036097
AA Change: V722A

Domain	Start	End	E-Value	Type
low complexity region	7	24	N/A	INTRINSIC
low complexity region	91	103	N/A	INTRINSIC
low complexity region	211	226	N/A	INTRINSIC
coiled coil region	239	266	N/A	INTRINSIC
low complexity region	495	514	N/A	INTRINSIC
low complexity region	528	539	N/A	INTRINSIC
low complexity region	549	568	N/A	INTRINSIC
low complexity region	572	582	N/A	INTRINSIC
low complexity region	601	616	N/A	INTRINSIC
Pfam:FAM178	647	1021	3.9e-146	PFAM

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.5%
20x: 89.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts15	A	G	9: 30,902,479	S797P	probably damaging	Het
Akap9	T	C	5: 3,961,783	Y829H	probably damaging	Het
Anp32a	A	G	9: 62,372,093	D74G	probably damaging	Het
B230118H07Rik	T	C	2: 101,610,571	E29G	probably damaging	Het
B3gat1	T	C	9: 26,751,816	I13T	probably damaging	Het
Cbfa2t3	A	T	8: 122,647,709	V99D	probably damaging	Het
Celsr2	C	T	3: 108,402,483	C1600Y	probably damaging	Het
Ddx31	T	A	2: 28,859,066	N291K	probably damaging	Het
Dennd1a	T	G	2: 37,852,434	M3L	probably benign	Het
Dnah12	C	T	14: 26,766,190	P1017L	probably damaging	Het
Dnajc6	A	T	4: 101,599,167	D86V	probably damaging	Het
Evx2	T	G	2: 74,657,851	K208N	probably damaging	Het
F13a1	A	G	13: 36,868,811	V718A	probably damaging	Het
Fcho2	T	C	13: 98,726,198	D757G	probably benign	Het
Fmnl2	A	G	2: 53,105,537	E424G	probably damaging	Het
Fryl	C	T	5: 73,074,751	W424*	probably null	Het
Gata3	G	T	2: 9,874,768	Y97*	probably null	Het
Gm15446	T	A	5: 109,942,457	C192S	probably damaging	Het
Hdac10	A	T	15: 89,125,318	D470E	probably benign	Het
Ier2	A	G	8: 84,662,426	L109P	probably benign	Het
Kcnh2	T	C	5: 24,322,219	T559A	probably benign	Het
Khk	C	T	5: 30,930,594	A204V	probably damaging	Het
Kndc1	T	A	7: 139,927,408	M1169K	possibly damaging	Het
Krtap31-1	A	G	11: 99,908,093	S41G	probably benign	Het
Nabp1	T	C	1: 51,473,003		probably null	Het
Nphp3	A	G	9: 104,035,840	D939G	probably benign	Het
Olfr513	A	T	7: 108,755,102	N82I	probably damaging	Het
Plcg2	T	C	8: 117,614,235	I1089T	possibly damaging	Het
Ptk2	A	T	15: 73,262,575	D558E	probably damaging	Het
Serpinb6d	A	G	13: 33,669,129	D168G	probably benign	Het
Shisa8	G	A	15: 82,208,555	P189L	probably damaging	Het
Shkbp1	A	G	7: 27,354,779	V89A	probably benign	Het
Slc40a1	C	T	1: 45,911,297	A332T	probably damaging	Het
Slc44a3	A	T	3: 121,497,847	Y373*	probably null	Het
Spanxn4	A	G	12: 62,687,838		noncoding transcript	Het
Stag3	T	A	5: 138,298,639		probably null	Het
Tanc1	T	C	2: 59,797,694	I612T	possibly damaging	Het
Thbs2	T	A	17: 14,685,781	M286L	probably benign	Het
Top1	T	A	2: 160,703,595	N294K	probably benign	Het
Tpr	T	G	1: 150,426,893	L1381V	probably damaging	Het
Trpm8	T	G	1: 88,326,432	S126A	probably benign	Het
Ttc41	A	G	10: 86,775,993	Y1075C	probably damaging	Het
Ubox5	C	T	2: 130,597,456	G418D	probably benign	Het
Vmn1r67	T	C	7: 10,446,980	V57A	possibly damaging	Het
Zbtb5	T	C	4: 44,993,500	H628R	probably damaging	Het
Zfp810	T	C	9: 22,278,920	I231V	probably benign	Het

Other mutations in Slf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01734:Slf2	APN	19	44973267	critical splice donor site	probably null
IGL01904:Slf2	APN	19	44949141	critical splice donor site	probably null
IGL02429:Slf2	APN	19	44941728	missense	probably benign
IGL02899:Slf2	APN	19	44942020	missense	probably benign	0.26
Evidentiary	UTSW	19	44938424	splice site	probably null
BB004:Slf2	UTSW	19	44935301	missense	probably damaging	0.97
BB014:Slf2	UTSW	19	44935301	missense	probably damaging	0.97
R0060:Slf2	UTSW	19	44948004	missense	probably damaging	1.00
R0731:Slf2	UTSW	19	44975726	splice site	probably benign
R1158:Slf2	UTSW	19	44931416	missense	probably damaging	0.99
R1590:Slf2	UTSW	19	44942073	nonsense	probably null
R1823:Slf2	UTSW	19	44935248	missense	possibly damaging	0.86
R2511:Slf2	UTSW	19	44941606	missense	possibly damaging	0.86
R3040:Slf2	UTSW	19	44980569	missense	probably damaging	0.99
R3236:Slf2	UTSW	19	44942334	missense	probably benign	0.33
R3237:Slf2	UTSW	19	44942334	missense	probably benign	0.33
R3552:Slf2	UTSW	19	44934951	nonsense	probably null
R3754:Slf2	UTSW	19	44973237	missense	probably benign
R4683:Slf2	UTSW	19	44935481	missense	probably benign	0.22
R4757:Slf2	UTSW	19	44935058	missense	probably benign
R4782:Slf2	UTSW	19	44934925	splice site	probably null
R4914:Slf2	UTSW	19	44971661	missense	probably damaging	0.96
R4915:Slf2	UTSW	19	44971661	missense	probably damaging	0.96
R4916:Slf2	UTSW	19	44971661	missense	probably damaging	0.96
R4917:Slf2	UTSW	19	44971661	missense	probably damaging	0.96
R4918:Slf2	UTSW	19	44971661	missense	probably damaging	0.96
R5069:Slf2	UTSW	19	44935253	missense	possibly damaging	0.94
R5092:Slf2	UTSW	19	44952084	missense	probably benign	0.14
R5215:Slf2	UTSW	19	44948037	missense	probably damaging	0.99
R5276:Slf2	UTSW	19	44935161	missense	possibly damaging	0.84
R5656:Slf2	UTSW	19	44973235	missense	probably benign	0.13
R6132:Slf2	UTSW	19	44960861	missense	possibly damaging	0.60
R6358:Slf2	UTSW	19	44935425	missense	probably benign	0.34
R6481:Slf2	UTSW	19	44973164	missense	probably benign	0.01
R6809:Slf2	UTSW	19	44943468	missense	probably damaging	0.98
R7263:Slf2	UTSW	19	44938424	splice site	probably null
R7912:Slf2	UTSW	19	44942243	missense	probably damaging	0.96
R7914:Slf2	UTSW	19	44959060	missense	possibly damaging	0.71
R7927:Slf2	UTSW	19	44935301	missense	probably damaging	0.97
R8006:Slf2	UTSW	19	44942317	missense	probably damaging	0.99
R8154:Slf2	UTSW	19	44935157	missense	possibly damaging	0.94
R8746:Slf2	UTSW	19	44973624	missense	probably damaging	1.00
R9075:Slf2	UTSW	19	44942421	missense	probably damaging	0.99
R9352:Slf2	UTSW	19	44943518	missense	probably null	0.97
R9354:Slf2	UTSW	19	44948032	missense	probably damaging	0.98
R9369:Slf2	UTSW	19	44935514	nonsense	probably null
R9412:Slf2	UTSW	19	44942021	missense	probably benign	0.31
R9743:Slf2	UTSW	19	44942133	missense	probably benign	0.40
R9778:Slf2	UTSW	19	44973227	missense	probably benign	0.04
Z1176:Slf2	UTSW	19	44941665	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AACACTTTACCTGCTGAGCCATCTC -3'
(R):5'- GCCTCACAGGCTACACCACTCTA -3'

Sequencing Primer
(F):5'- cgggaggcagagacagac -3'
(R):5'- ctcttaaccattgagctatctttcc -3'

Posted On

2014-04-24