Incidental Mutation 'R1608:Slf2'
ID176652
Institutional Source Beutler Lab
Gene Symbol Slf2
Ensembl Gene ENSMUSG00000036097
Gene NameSMC5-SMC6 complex localization factor 2
SynonymsFam178a, 6030443O07Rik
MMRRC Submission 039645-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.903) question?
Stock #R1608 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location44931119-44983787 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44949001 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 722 (V722A)
Ref Sequence ENSEMBL: ENSMUSP00000093758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096053]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083225
Predicted Effect probably benign
Transcript: ENSMUST00000096053
AA Change: V722A

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000093758
Gene: ENSMUSG00000036097
AA Change: V722A

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
low complexity region 91 103 N/A INTRINSIC
low complexity region 211 226 N/A INTRINSIC
coiled coil region 239 266 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 549 568 N/A INTRINSIC
low complexity region 572 582 N/A INTRINSIC
low complexity region 601 616 N/A INTRINSIC
Pfam:FAM178 647 1021 3.9e-146 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 A G 9: 30,902,479 S797P probably damaging Het
Akap9 T C 5: 3,961,783 Y829H probably damaging Het
Anp32a A G 9: 62,372,093 D74G probably damaging Het
B230118H07Rik T C 2: 101,610,571 E29G probably damaging Het
B3gat1 T C 9: 26,751,816 I13T probably damaging Het
Cbfa2t3 A T 8: 122,647,709 V99D probably damaging Het
Celsr2 C T 3: 108,402,483 C1600Y probably damaging Het
Ddx31 T A 2: 28,859,066 N291K probably damaging Het
Dennd1a T G 2: 37,852,434 M3L probably benign Het
Dnah12 C T 14: 26,766,190 P1017L probably damaging Het
Dnajc6 A T 4: 101,599,167 D86V probably damaging Het
Evx2 T G 2: 74,657,851 K208N probably damaging Het
F13a1 A G 13: 36,868,811 V718A probably damaging Het
Fcho2 T C 13: 98,726,198 D757G probably benign Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Fryl C T 5: 73,074,751 W424* probably null Het
Gata3 G T 2: 9,874,768 Y97* probably null Het
Gm15446 T A 5: 109,942,457 C192S probably damaging Het
Hdac10 A T 15: 89,125,318 D470E probably benign Het
Ier2 A G 8: 84,662,426 L109P probably benign Het
Kcnh2 T C 5: 24,322,219 T559A probably benign Het
Khk C T 5: 30,930,594 A204V probably damaging Het
Kndc1 T A 7: 139,927,408 M1169K possibly damaging Het
Krtap31-1 A G 11: 99,908,093 S41G probably benign Het
Nabp1 T C 1: 51,473,003 probably null Het
Nphp3 A G 9: 104,035,840 D939G probably benign Het
Olfr513 A T 7: 108,755,102 N82I probably damaging Het
Plcg2 T C 8: 117,614,235 I1089T possibly damaging Het
Ptk2 A T 15: 73,262,575 D558E probably damaging Het
Serpinb6d A G 13: 33,669,129 D168G probably benign Het
Shisa8 G A 15: 82,208,555 P189L probably damaging Het
Shkbp1 A G 7: 27,354,779 V89A probably benign Het
Slc40a1 C T 1: 45,911,297 A332T probably damaging Het
Slc44a3 A T 3: 121,497,847 Y373* probably null Het
Spanxn4 A G 12: 62,687,838 noncoding transcript Het
Stag3 T A 5: 138,298,639 probably null Het
Tanc1 T C 2: 59,797,694 I612T possibly damaging Het
Thbs2 T A 17: 14,685,781 M286L probably benign Het
Top1 T A 2: 160,703,595 N294K probably benign Het
Tpr T G 1: 150,426,893 L1381V probably damaging Het
Trpm8 T G 1: 88,326,432 S126A probably benign Het
Ttc41 A G 10: 86,775,993 Y1075C probably damaging Het
Ubox5 C T 2: 130,597,456 G418D probably benign Het
Vmn1r67 T C 7: 10,446,980 V57A possibly damaging Het
Zbtb5 T C 4: 44,993,500 H628R probably damaging Het
Zfp810 T C 9: 22,278,920 I231V probably benign Het
Other mutations in Slf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Slf2 APN 19 44973267 critical splice donor site probably null
IGL01904:Slf2 APN 19 44949141 critical splice donor site probably null
IGL02429:Slf2 APN 19 44941728 missense probably benign
IGL02899:Slf2 APN 19 44942020 missense probably benign 0.26
R0060:Slf2 UTSW 19 44948004 missense probably damaging 1.00
R0731:Slf2 UTSW 19 44975726 splice site probably benign
R1158:Slf2 UTSW 19 44931416 missense probably damaging 0.99
R1590:Slf2 UTSW 19 44942073 nonsense probably null
R1823:Slf2 UTSW 19 44935248 missense possibly damaging 0.86
R2511:Slf2 UTSW 19 44941606 missense possibly damaging 0.86
R3040:Slf2 UTSW 19 44980569 missense probably damaging 0.99
R3236:Slf2 UTSW 19 44942334 missense probably benign 0.33
R3237:Slf2 UTSW 19 44942334 missense probably benign 0.33
R3552:Slf2 UTSW 19 44934951 nonsense probably null
R3754:Slf2 UTSW 19 44973237 missense probably benign
R4683:Slf2 UTSW 19 44935481 missense probably benign 0.22
R4757:Slf2 UTSW 19 44935058 missense probably benign
R4782:Slf2 UTSW 19 44934925 splice site probably null
R4914:Slf2 UTSW 19 44971661 missense probably damaging 0.96
R4915:Slf2 UTSW 19 44971661 missense probably damaging 0.96
R4916:Slf2 UTSW 19 44971661 missense probably damaging 0.96
R4917:Slf2 UTSW 19 44971661 missense probably damaging 0.96
R4918:Slf2 UTSW 19 44971661 missense probably damaging 0.96
R5069:Slf2 UTSW 19 44935253 missense possibly damaging 0.94
R5092:Slf2 UTSW 19 44952084 missense probably benign 0.14
R5215:Slf2 UTSW 19 44948037 missense probably damaging 0.99
R5276:Slf2 UTSW 19 44935161 missense possibly damaging 0.84
R5656:Slf2 UTSW 19 44973235 missense probably benign 0.13
R6132:Slf2 UTSW 19 44960861 missense possibly damaging 0.60
R6358:Slf2 UTSW 19 44935425 missense probably benign 0.34
R6481:Slf2 UTSW 19 44973164 missense probably benign 0.01
R6809:Slf2 UTSW 19 44943468 missense probably damaging 0.98
R7263:Slf2 UTSW 19 44938424 splice site probably null
R7912:Slf2 UTSW 19 44942243 missense probably damaging 0.96
R7993:Slf2 UTSW 19 44942243 missense probably damaging 0.96
R8006:Slf2 UTSW 19 44942317 missense probably damaging 0.99
Z1176:Slf2 UTSW 19 44941665 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACACTTTACCTGCTGAGCCATCTC -3'
(R):5'- GCCTCACAGGCTACACCACTCTA -3'

Sequencing Primer
(F):5'- cgggaggcagagacagac -3'
(R):5'- ctcttaaccattgagctatctttcc -3'
Posted On2014-04-24