Incidental Mutation 'R1608:Slf2'
ID 176652
Institutional Source Beutler Lab
Gene Symbol Slf2
Ensembl Gene ENSMUSG00000036097
Gene Name SMC5-SMC6 complex localization factor 2
Synonyms 6030443O07Rik, Fam178a
MMRRC Submission 039645-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.910) question?
Stock # R1608 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 44919590-44971738 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 44937440 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 722 (V722A)
Ref Sequence ENSEMBL: ENSMUSP00000093758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096053]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083225
Predicted Effect probably benign
Transcript: ENSMUST00000096053
AA Change: V722A

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000093758
Gene: ENSMUSG00000036097
AA Change: V722A

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
low complexity region 91 103 N/A INTRINSIC
low complexity region 211 226 N/A INTRINSIC
coiled coil region 239 266 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 549 568 N/A INTRINSIC
low complexity region 572 582 N/A INTRINSIC
low complexity region 601 616 N/A INTRINSIC
Pfam:FAM178 647 1021 3.9e-146 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 A G 9: 30,813,775 (GRCm39) S797P probably damaging Het
Akap9 T C 5: 4,011,783 (GRCm39) Y829H probably damaging Het
Anp32a A G 9: 62,279,375 (GRCm39) D74G probably damaging Het
B3gat1 T C 9: 26,663,112 (GRCm39) I13T probably damaging Het
Cbfa2t3 A T 8: 123,374,448 (GRCm39) V99D probably damaging Het
Celsr2 C T 3: 108,309,799 (GRCm39) C1600Y probably damaging Het
Ddx31 T A 2: 28,749,078 (GRCm39) N291K probably damaging Het
Dennd1a T G 2: 37,742,446 (GRCm39) M3L probably benign Het
Dnah12 C T 14: 26,488,147 (GRCm39) P1017L probably damaging Het
Dnajc6 A T 4: 101,456,364 (GRCm39) D86V probably damaging Het
Evx2 T G 2: 74,488,195 (GRCm39) K208N probably damaging Het
F13a1 A G 13: 37,052,785 (GRCm39) V718A probably damaging Het
Fcho2 T C 13: 98,862,706 (GRCm39) D757G probably benign Het
Fmnl2 A G 2: 52,995,549 (GRCm39) E424G probably damaging Het
Fryl C T 5: 73,232,094 (GRCm39) W424* probably null Het
Gata3 G T 2: 9,879,579 (GRCm39) Y97* probably null Het
Gm15446 T A 5: 110,090,323 (GRCm39) C192S probably damaging Het
Hdac10 A T 15: 89,009,521 (GRCm39) D470E probably benign Het
Ier2 A G 8: 85,389,055 (GRCm39) L109P probably benign Het
Iftap T C 2: 101,440,916 (GRCm39) E29G probably damaging Het
Kcnh2 T C 5: 24,527,217 (GRCm39) T559A probably benign Het
Khk C T 5: 31,087,938 (GRCm39) A204V probably damaging Het
Kndc1 T A 7: 139,507,321 (GRCm39) M1169K possibly damaging Het
Krtap31-1 A G 11: 99,798,919 (GRCm39) S41G probably benign Het
Nabp1 T C 1: 51,512,162 (GRCm39) probably null Het
Nphp3 A G 9: 103,913,039 (GRCm39) D939G probably benign Het
Or5e1 A T 7: 108,354,309 (GRCm39) N82I probably damaging Het
Plcg2 T C 8: 118,340,974 (GRCm39) I1089T possibly damaging Het
Ptk2 A T 15: 73,134,424 (GRCm39) D558E probably damaging Het
Serpinb6d A G 13: 33,853,112 (GRCm39) D168G probably benign Het
Shisa8 G A 15: 82,092,756 (GRCm39) P189L probably damaging Het
Shkbp1 A G 7: 27,054,204 (GRCm39) V89A probably benign Het
Slc40a1 C T 1: 45,950,457 (GRCm39) A332T probably damaging Het
Slc44a3 A T 3: 121,291,496 (GRCm39) Y373* probably null Het
Spanxn4 A G 12: 62,734,624 (GRCm39) noncoding transcript Het
Stag3 T A 5: 138,296,901 (GRCm39) probably null Het
Tanc1 T C 2: 59,628,038 (GRCm39) I612T possibly damaging Het
Thbs2 T A 17: 14,906,043 (GRCm39) M286L probably benign Het
Top1 T A 2: 160,545,515 (GRCm39) N294K probably benign Het
Tpr T G 1: 150,302,644 (GRCm39) L1381V probably damaging Het
Trpm8 T G 1: 88,254,154 (GRCm39) S126A probably benign Het
Ttc41 A G 10: 86,611,857 (GRCm39) Y1075C probably damaging Het
Ubox5 C T 2: 130,439,376 (GRCm39) G418D probably benign Het
Vmn1r67 T C 7: 10,180,907 (GRCm39) V57A possibly damaging Het
Zbtb5 T C 4: 44,993,500 (GRCm39) H628R probably damaging Het
Zfp810 T C 9: 22,190,216 (GRCm39) I231V probably benign Het
Other mutations in Slf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01734:Slf2 APN 19 44,961,706 (GRCm39) critical splice donor site probably null
IGL01904:Slf2 APN 19 44,937,580 (GRCm39) critical splice donor site probably null
IGL02429:Slf2 APN 19 44,930,167 (GRCm39) missense probably benign
IGL02899:Slf2 APN 19 44,930,459 (GRCm39) missense probably benign 0.26
Evidentiary UTSW 19 44,926,863 (GRCm39) splice site probably null
BB004:Slf2 UTSW 19 44,923,740 (GRCm39) missense probably damaging 0.97
BB014:Slf2 UTSW 19 44,923,740 (GRCm39) missense probably damaging 0.97
R0060:Slf2 UTSW 19 44,936,443 (GRCm39) missense probably damaging 1.00
R0731:Slf2 UTSW 19 44,964,165 (GRCm39) splice site probably benign
R1158:Slf2 UTSW 19 44,919,855 (GRCm39) missense probably damaging 0.99
R1590:Slf2 UTSW 19 44,930,512 (GRCm39) nonsense probably null
R1823:Slf2 UTSW 19 44,923,687 (GRCm39) missense possibly damaging 0.86
R2511:Slf2 UTSW 19 44,930,045 (GRCm39) missense possibly damaging 0.86
R3040:Slf2 UTSW 19 44,969,008 (GRCm39) missense probably damaging 0.99
R3236:Slf2 UTSW 19 44,930,773 (GRCm39) missense probably benign 0.33
R3237:Slf2 UTSW 19 44,930,773 (GRCm39) missense probably benign 0.33
R3552:Slf2 UTSW 19 44,923,390 (GRCm39) nonsense probably null
R3754:Slf2 UTSW 19 44,961,676 (GRCm39) missense probably benign
R4683:Slf2 UTSW 19 44,923,920 (GRCm39) missense probably benign 0.22
R4757:Slf2 UTSW 19 44,923,497 (GRCm39) missense probably benign
R4782:Slf2 UTSW 19 44,923,364 (GRCm39) splice site probably null
R4914:Slf2 UTSW 19 44,960,100 (GRCm39) missense probably damaging 0.96
R4915:Slf2 UTSW 19 44,960,100 (GRCm39) missense probably damaging 0.96
R4916:Slf2 UTSW 19 44,960,100 (GRCm39) missense probably damaging 0.96
R4917:Slf2 UTSW 19 44,960,100 (GRCm39) missense probably damaging 0.96
R4918:Slf2 UTSW 19 44,960,100 (GRCm39) missense probably damaging 0.96
R5069:Slf2 UTSW 19 44,923,692 (GRCm39) missense possibly damaging 0.94
R5092:Slf2 UTSW 19 44,940,523 (GRCm39) missense probably benign 0.14
R5215:Slf2 UTSW 19 44,936,476 (GRCm39) missense probably damaging 0.99
R5276:Slf2 UTSW 19 44,923,600 (GRCm39) missense possibly damaging 0.84
R5656:Slf2 UTSW 19 44,961,674 (GRCm39) missense probably benign 0.13
R6132:Slf2 UTSW 19 44,949,300 (GRCm39) missense possibly damaging 0.60
R6358:Slf2 UTSW 19 44,923,864 (GRCm39) missense probably benign 0.34
R6481:Slf2 UTSW 19 44,961,603 (GRCm39) missense probably benign 0.01
R6809:Slf2 UTSW 19 44,931,907 (GRCm39) missense probably damaging 0.98
R7263:Slf2 UTSW 19 44,926,863 (GRCm39) splice site probably null
R7912:Slf2 UTSW 19 44,930,682 (GRCm39) missense probably damaging 0.96
R7914:Slf2 UTSW 19 44,947,499 (GRCm39) missense possibly damaging 0.71
R7927:Slf2 UTSW 19 44,923,740 (GRCm39) missense probably damaging 0.97
R8006:Slf2 UTSW 19 44,930,756 (GRCm39) missense probably damaging 0.99
R8154:Slf2 UTSW 19 44,923,596 (GRCm39) missense possibly damaging 0.94
R8746:Slf2 UTSW 19 44,962,063 (GRCm39) missense probably damaging 1.00
R9075:Slf2 UTSW 19 44,930,860 (GRCm39) missense probably damaging 0.99
R9352:Slf2 UTSW 19 44,931,957 (GRCm39) missense probably null 0.97
R9354:Slf2 UTSW 19 44,936,471 (GRCm39) missense probably damaging 0.98
R9369:Slf2 UTSW 19 44,923,953 (GRCm39) nonsense probably null
R9412:Slf2 UTSW 19 44,930,460 (GRCm39) missense probably benign 0.31
R9743:Slf2 UTSW 19 44,930,572 (GRCm39) missense probably benign 0.40
R9778:Slf2 UTSW 19 44,961,666 (GRCm39) missense probably benign 0.04
Z1176:Slf2 UTSW 19 44,930,104 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACACTTTACCTGCTGAGCCATCTC -3'
(R):5'- GCCTCACAGGCTACACCACTCTA -3'

Sequencing Primer
(F):5'- cgggaggcagagacagac -3'
(R):5'- ctcttaaccattgagctatctttcc -3'
Posted On 2014-04-24