Mutagenetix > Incidental Mutation

Incidental Mutation 'R1609:Dnah14'

176655

Institutional Source

Beutler Lab

Gene Symbol

Dnah14

Ensembl Gene

ENSMUSG00000047369

Gene Name

dynein, axonemal, heavy chain 14

Synonyms

Dnahc14, Gm980, LOC381311, A230079K17Rik

MMRRC Submission

039646-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R1609 (G1)

Quality Score

121

Status

Validated

Chromosome

Chromosomal Location

181576559-181815774 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 181750177 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 3020 (S3020P)

Ref Sequence

ENSEMBL: ENSMUSP00000146843 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000208001]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000097446

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160345

SMART Domains

Protein: ENSMUSP00000124817
Gene: ENSMUSG00000047369

Domain	Start	End	E-Value	Type
Pfam:MT	46	381	2.1e-41	PFAM
Pfam:AAA_9	401	524	8.3e-35	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160793

Predicted Effect

probably damaging
Transcript: ENSMUST00000208001
AA Change: S3020P

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

Meta Mutation Damage Score

0.0980

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.1%
20x: 88.1%

Validation Efficiency

96% (49/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot2	C	T	12: 83,992,856	R380C	possibly damaging	Het
Allc	A	T	12: 28,553,994	D363E	probably damaging	Het
Anxa2	TCCC	TCC	9: 69,489,754		probably null	Het
App	C	A	16: 85,079,949	V185L	probably damaging	Het
Atpif1	T	C	4: 132,530,767	D47G	probably benign	Het
Auh	G	A	13: 52,835,496	P308L	probably benign	Het
Cbr4	T	A	8: 61,503,158	Y220N	probably damaging	Het
Ccdc6	C	A	10: 70,167,047	Q203K	probably damaging	Het
Cntnap2	T	C	6: 46,015,330	V397A	probably benign	Het
Dmxl2	A	G	9: 54,409,263	I1613T	possibly damaging	Het
Dnah7b	T	C	1: 46,352,966	L3829P	probably damaging	Het
Fbxw25	C	T	9: 109,663,510	C53Y	probably benign	Het
Fndc1	G	T	17: 7,772,766	H699Q	unknown	Het
Gnaq	G	A	19: 16,383,254	V314M	possibly damaging	Het
Gpr158	A	G	2: 21,783,293	T582A	possibly damaging	Het
Mapk1	T	C	16: 17,038,306		probably benign	Het
Med1	T	A	11: 98,161,170	H456L	possibly damaging	Het
Myo6	G	A	9: 80,288,217		probably null	Het
Nipbl	A	G	15: 8,366,664	Y142H	probably damaging	Het
Olfr1058	A	G	2: 86,385,494	I308T	probably benign	Het
Olfr1080	A	C	2: 86,553,605	V173G	probably damaging	Het
Olfr1218	A	T	2: 89,055,344	F27L	probably benign	Het
Pgbd5	T	C	8: 124,434,011	D39G	probably benign	Het
Pnisr	G	T	4: 21,871,440	G387*	probably null	Het
Pnpla6	T	C	8: 3,517,135	L61P	probably damaging	Het
Prkra	A	T	2: 76,633,592	I242N	probably benign	Het
Rp1	A	G	1: 4,349,201	S563P	probably damaging	Het
Rtp3	A	G	9: 110,986,017		probably benign	Het
Sema3d	A	G	5: 12,541,056	T301A	probably damaging	Het
Setmar	A	G	6: 108,076,115	D190G	probably benign	Het
Sf3b2	A	G	19: 5,295,033		probably benign	Het
Taf4b	A	G	18: 14,835,881	K692E	probably damaging	Het
Tktl2	A	G	8: 66,512,852	E354G	probably benign	Het
Tspan4	A	G	7: 141,491,644	T135A	probably damaging	Het
Vmn1r22	G	T	6: 57,900,748	Y81*	probably null	Het
Vmn2r31	T	C	7: 7,384,889	E561G	probably damaging	Het
Xrn1	A	T	9: 95,974,893	K389N	probably benign	Het
Zfp277	A	T	12: 40,328,720	N379K	probably damaging	Het

Other mutations in Dnah14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Dnah14	APN	1	181752046	missense	probably benign	0.17
IGL01764:Dnah14	APN	1	181744777	missense	probably benign	0.00
IGL03218:Dnah14	APN	1	181755269	missense	probably benign	0.02
IGL03290:Dnah14	APN	1	181763978	splice site	probably benign
IGL03384:Dnah14	APN	1	181745949	missense	probably benign	0.03
R0009:Dnah14	UTSW	1	181769407	splice site	probably benign
R0125:Dnah14	UTSW	1	181752063	missense	probably damaging	0.99
R0579:Dnah14	UTSW	1	181744747	missense	possibly damaging	0.72
R0973:Dnah14	UTSW	1	181752145	missense	probably damaging	1.00
R0973:Dnah14	UTSW	1	181752145	missense	probably damaging	1.00
R0974:Dnah14	UTSW	1	181752145	missense	probably damaging	1.00
R1860:Dnah14	UTSW	1	181763960	missense	probably damaging	1.00
R2050:Dnah14	UTSW	1	181752562	missense	probably damaging	1.00
R2974:Dnah14	UTSW	1	181755241	critical splice acceptor site	probably null
R4715:Dnah14	UTSW	1	181757223	missense	probably damaging	1.00
R5076:Dnah14	UTSW	1	181757234	missense	probably benign	0.01
R5424:Dnah14	UTSW	1	181763310	missense	possibly damaging	0.95
R5808:Dnah14	UTSW	1	181741159	missense	possibly damaging	0.72
R5997:Dnah14	UTSW	1	181770105	missense	probably benign	0.00
R6052:Dnah14	UTSW	1	181666487	missense	possibly damaging	0.50
R6061:Dnah14	UTSW	1	181709051	missense	probably damaging	1.00
R6089:Dnah14	UTSW	1	181750154	missense	probably damaging	1.00
R6092:Dnah14	UTSW	1	181621833	missense	probably benign	0.13
R6145:Dnah14	UTSW	1	181666417	missense	probably benign	0.00
R6163:Dnah14	UTSW	1	181666361	missense	probably benign	0.33
R6246:Dnah14	UTSW	1	181680888	missense	probably benign	0.00
R6302:Dnah14	UTSW	1	181601206	missense	possibly damaging	0.96
R6306:Dnah14	UTSW	1	181585024	frame shift	probably null
R6326:Dnah14	UTSW	1	181783556	missense	probably damaging	1.00
R6348:Dnah14	UTSW	1	181626720	missense	possibly damaging	0.83
R6367:Dnah14	UTSW	1	181755386	splice site	probably null
R6376:Dnah14	UTSW	1	181605894	missense	possibly damaging	0.79
R6389:Dnah14	UTSW	1	181651202	critical splice donor site	probably null
R6433:Dnah14	UTSW	1	181651657	missense	probably damaging	0.99
R6454:Dnah14	UTSW	1	181783705	missense	probably damaging	1.00
R6476:Dnah14	UTSW	1	181744768	missense	probably benign	0.26
R6523:Dnah14	UTSW	1	181643621	missense	probably benign	0.00
R6529:Dnah14	UTSW	1	181666469	missense	probably damaging	0.98
R6538:Dnah14	UTSW	1	181584985	missense	unknown
R6546:Dnah14	UTSW	1	181738987	missense	probably damaging	1.00
R6752:Dnah14	UTSW	1	181593452	missense	probably benign	0.07
R6762:Dnah14	UTSW	1	181757259	missense	probably damaging	1.00
R6786:Dnah14	UTSW	1	181641405	missense	probably benign	0.21
R6849:Dnah14	UTSW	1	181808945	missense	probably benign	0.00
R6877:Dnah14	UTSW	1	181628432	missense	possibly damaging	0.82
R6912:Dnah14	UTSW	1	181750183	missense	possibly damaging	0.83
R6919:Dnah14	UTSW	1	181585066	missense	probably benign	0.04
R6924:Dnah14	UTSW	1	181627952	missense	probably benign	0.04
R6957:Dnah14	UTSW	1	181785175	missense	possibly damaging	0.92
R6980:Dnah14	UTSW	1	181648230	missense	probably benign	0.00
R7018:Dnah14	UTSW	1	181626944	missense	possibly damaging	0.55
R7046:Dnah14	UTSW	1	181623003	missense	probably benign	0.01
R7058:Dnah14	UTSW	1	181698049	missense	probably benign	0.00
R7068:Dnah14	UTSW	1	181769790	missense	probably benign	0.35
R7115:Dnah14	UTSW	1	181720145	missense	probably damaging	1.00
R7130:Dnah14	UTSW	1	181745958	nonsense	probably null
R7165:Dnah14	UTSW	1	181704535	missense	probably benign	0.00
R7169:Dnah14	UTSW	1	181702365	missense	probably benign	0.00
R7184:Dnah14	UTSW	1	181704529	nonsense	probably null
R7232:Dnah14	UTSW	1	181757363	missense	probably damaging	1.00
R7260:Dnah14	UTSW	1	181706744	missense	probably damaging	0.99
R7276:Dnah14	UTSW	1	181685807	missense	probably benign	0.41
R7290:Dnah14	UTSW	1	181628174	missense	probably benign	0.20
R7314:Dnah14	UTSW	1	181785254	splice site	probably null
R7326:Dnah14	UTSW	1	181598403	missense	probably benign	0.02
R7336:Dnah14	UTSW	1	181797734	missense	probably damaging	0.96
R7363:Dnah14	UTSW	1	181690524	splice site	probably null
R7371:Dnah14	UTSW	1	181626885	missense	probably benign	0.05
R7376:Dnah14	UTSW	1	181763402	missense	probably benign	0.03
R7418:Dnah14	UTSW	1	181616742	missense	possibly damaging	0.92
R7473:Dnah14	UTSW	1	181752139	missense	probably damaging	0.99
R7514:Dnah14	UTSW	1	181628067	missense	probably damaging	0.96
R7555:Dnah14	UTSW	1	181770054	missense	probably benign	0.26
R7641:Dnah14	UTSW	1	181707533	missense	probably benign	0.01
R7663:Dnah14	UTSW	1	181752155	splice site	probably null
R7674:Dnah14	UTSW	1	181707533	missense	probably benign	0.01
R7680:Dnah14	UTSW	1	181685800	missense	probably benign	0.15
R7709:Dnah14	UTSW	1	181702484	critical splice donor site	probably null
R7842:Dnah14	UTSW	1	181627898	missense	probably damaging	0.99
R7861:Dnah14	UTSW	1	181616759	missense	probably damaging	1.00
R7988:Dnah14	UTSW	1	181783574	missense	probably damaging	0.97
R8016:Dnah14	UTSW	1	181648311	missense	probably benign	0.05
R8042:Dnah14	UTSW	1	181643631	critical splice donor site	probably null
R8071:Dnah14	UTSW	1	181615894	missense	possibly damaging	0.84
R8086:Dnah14	UTSW	1	181766232	missense	probably damaging	1.00
R8095:Dnah14	UTSW	1	181806032	nonsense	probably null
R8139:Dnah14	UTSW	1	181755288	missense	probably damaging	1.00
R8176:Dnah14	UTSW	1	181657033	missense	probably damaging	0.96
R8193:Dnah14	UTSW	1	181688205	missense	probably damaging	1.00
R8197:Dnah14	UTSW	1	181690101	missense	possibly damaging	0.94
R8209:Dnah14	UTSW	1	181795545	missense	possibly damaging	0.69
R8226:Dnah14	UTSW	1	181795545	missense	possibly damaging	0.69
R8251:Dnah14	UTSW	1	181664865	missense	probably damaging	1.00
R8264:Dnah14	UTSW	1	181744792	missense	probably damaging	0.99
R8284:Dnah14	UTSW	1	181773811	missense	probably benign	0.03
R8289:Dnah14	UTSW	1	181716215	nonsense	probably null
R8323:Dnah14	UTSW	1	181704544	missense	probably benign	0.01
R8442:Dnah14	UTSW	1	181741284	missense	probably damaging	0.97
R8458:Dnah14	UTSW	1	181806012	missense
R8507:Dnah14	UTSW	1	181641414	missense	probably benign	0.02
R8509:Dnah14	UTSW	1	181814655	missense
R8520:Dnah14	UTSW	1	181653638	missense	probably damaging	1.00
R8530:Dnah14	UTSW	1	181664946	missense	probably damaging	1.00
R8703:Dnah14	UTSW	1	181666011	nonsense	probably null
R8710:Dnah14	UTSW	1	181690311	missense	probably benign	0.04
R8752:Dnah14	UTSW	1	181628016	missense	probably benign	0.00
R8792:Dnah14	UTSW	1	181814624	missense
R8797:Dnah14	UTSW	1	181637847	missense	probably benign	0.19
R8821:Dnah14	UTSW	1	181792004	nonsense	probably null
R8834:Dnah14	UTSW	1	181616750	missense	possibly damaging	0.83
R8913:Dnah14	UTSW	1	181725498	missense	probably benign	0.01
R8925:Dnah14	UTSW	1	181680756	missense	probably damaging	1.00
R8927:Dnah14	UTSW	1	181680756	missense	probably damaging	1.00
R8934:Dnah14	UTSW	1	181622723	missense	possibly damaging	0.84
R9090:Dnah14	UTSW	1	181769760	missense	probably benign	0.33
R9169:Dnah14	UTSW	1	181605816	missense	probably benign	0.06
R9199:Dnah14	UTSW	1	181651001	missense	possibly damaging	0.50
R9212:Dnah14	UTSW	1	181801287	missense	possibly damaging	0.95
R9213:Dnah14	UTSW	1	181616640	critical splice donor site	probably null
R9271:Dnah14	UTSW	1	181769760	missense	probably benign	0.33
R9282:Dnah14	UTSW	1	181814512	missense
R9350:Dnah14	UTSW	1	181734804	missense	possibly damaging	0.79
R9358:Dnah14	UTSW	1	181709033	missense	probably benign	0.01
R9436:Dnah14	UTSW	1	181680783	missense	probably damaging	1.00
R9484:Dnah14	UTSW	1	181690208	missense	probably benign	0.45
R9484:Dnah14	UTSW	1	181797746	missense	probably benign	0.01
R9486:Dnah14	UTSW	1	181680929	missense	possibly damaging	0.68
R9546:Dnah14	UTSW	1	181593427	critical splice acceptor site	probably null
R9547:Dnah14	UTSW	1	181593427	critical splice acceptor site	probably null
R9578:Dnah14	UTSW	1	181674442	missense	probably benign	0.16
R9654:Dnah14	UTSW	1	181766339	missense	probably benign	0.01
R9681:Dnah14	UTSW	1	181734849	missense	possibly damaging	0.91
R9683:Dnah14	UTSW	1	181598944	missense	probably benign	0.01
R9687:Dnah14	UTSW	1	181598413	missense	probably benign	0.01
R9718:Dnah14	UTSW	1	181622979	missense	probably benign	0.08
R9751:Dnah14	UTSW	1	181792045	missense	probably damaging	1.00
R9757:Dnah14	UTSW	1	181685784	missense	probably benign	0.03
RF007:Dnah14	UTSW	1	181685809	missense	probably benign	0.00
RF012:Dnah14	UTSW	1	181627898	missense	probably damaging	0.99
Z1176:Dnah14	UTSW	1	181757351	missense	possibly damaging	0.83
Z1177:Dnah14	UTSW	1	181690320	missense	probably benign	0.03
Z1177:Dnah14	UTSW	1	181763334	missense	probably damaging	1.00
Z1177:Dnah14	UTSW	1	181766304	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCATTTGACCTTCTTCCTAAGGCAA -3'
(R):5'- ACGCCATCTTCCATGTGTGATACATTT -3'

Sequencing Primer
(F):5'- agatagataATGAAAGCAGAAGGGAG -3'
(R):5'- TACCTTGTCAGGGATGCTGT -3'

Posted On

2014-04-24