Incidental Mutation 'R1609:Olfr1080'
ID176661
Institutional Source Beutler Lab
Gene Symbol Olfr1080
Ensembl Gene ENSMUSG00000110912
Gene Nameolfactory receptor 1080
SynonymsMOR192-1, GA_x6K02T2Q125-48039418-48038477
MMRRC Submission 039646-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R1609 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86552675-86558235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 86553605 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 173 (V173G)
Ref Sequence ENSEMBL: ENSMUSP00000150502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000213185]
Predicted Effect probably damaging
Transcript: ENSMUST00000099881
AA Change: V173G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097466
Gene: ENSMUSG00000075178
AA Change: V173G

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 1.5e-30 PFAM
Pfam:7tm_4 139 283 1.4e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111580
AA Change: V173G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107206
Gene: ENSMUSG00000075178
AA Change: V173G

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 9.1e-48 PFAM
Pfam:7tm_1 41 290 7.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213185
AA Change: V173G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.2353 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.1%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 C T 12: 83,992,856 R380C possibly damaging Het
Allc A T 12: 28,553,994 D363E probably damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
App C A 16: 85,079,949 V185L probably damaging Het
Atpif1 T C 4: 132,530,767 D47G probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Cbr4 T A 8: 61,503,158 Y220N probably damaging Het
Ccdc6 C A 10: 70,167,047 Q203K probably damaging Het
Cntnap2 T C 6: 46,015,330 V397A probably benign Het
Dmxl2 A G 9: 54,409,263 I1613T possibly damaging Het
Dnah14 T C 1: 181,750,177 S3020P probably damaging Het
Dnah7b T C 1: 46,352,966 L3829P probably damaging Het
Fbxw25 C T 9: 109,663,510 C53Y probably benign Het
Fndc1 G T 17: 7,772,766 H699Q unknown Het
Gnaq G A 19: 16,383,254 V314M possibly damaging Het
Gpr158 A G 2: 21,783,293 T582A possibly damaging Het
Mapk1 T C 16: 17,038,306 probably benign Het
Med1 T A 11: 98,161,170 H456L possibly damaging Het
Myo6 G A 9: 80,288,217 probably null Het
Nipbl A G 15: 8,366,664 Y142H probably damaging Het
Olfr1058 A G 2: 86,385,494 I308T probably benign Het
Olfr1218 A T 2: 89,055,344 F27L probably benign Het
Pgbd5 T C 8: 124,434,011 D39G probably benign Het
Pnisr G T 4: 21,871,440 G387* probably null Het
Pnpla6 T C 8: 3,517,135 L61P probably damaging Het
Prkra A T 2: 76,633,592 I242N probably benign Het
Rp1 A G 1: 4,349,201 S563P probably damaging Het
Rtp3 A G 9: 110,986,017 probably benign Het
Sema3d A G 5: 12,541,056 T301A probably damaging Het
Setmar A G 6: 108,076,115 D190G probably benign Het
Sf3b2 A G 19: 5,295,033 probably benign Het
Taf4b A G 18: 14,835,881 K692E probably damaging Het
Tktl2 A G 8: 66,512,852 E354G probably benign Het
Tspan4 A G 7: 141,491,644 T135A probably damaging Het
Vmn1r22 G T 6: 57,900,748 Y81* probably null Het
Vmn2r31 T C 7: 7,384,889 E561G probably damaging Het
Xrn1 A T 9: 95,974,893 K389N probably benign Het
Zfp277 A T 12: 40,328,720 N379K probably damaging Het
Other mutations in Olfr1080
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01937:Olfr1080 APN 2 86553449 missense probably benign 0.34
IGL02169:Olfr1080 APN 2 86553882 missense probably benign 0.39
IGL02234:Olfr1080 APN 2 86553266 missense probably damaging 1.00
IGL02530:Olfr1080 APN 2 86553880 missense possibly damaging 0.60
R0046:Olfr1080 UTSW 2 86553632 missense probably damaging 1.00
R0360:Olfr1080 UTSW 2 86553779 missense probably damaging 1.00
R0364:Olfr1080 UTSW 2 86553779 missense probably damaging 1.00
R0377:Olfr1080 UTSW 2 86553583 missense probably damaging 1.00
R1496:Olfr1080 UTSW 2 86553752 missense probably damaging 1.00
R1674:Olfr1080 UTSW 2 86553860 missense probably damaging 0.96
R1816:Olfr1080 UTSW 2 86553667 nonsense probably null
R2870:Olfr1080 UTSW 2 86553584 missense possibly damaging 0.95
R2870:Olfr1080 UTSW 2 86553584 missense possibly damaging 0.95
R4387:Olfr1080 UTSW 2 86553954 missense probably damaging 1.00
R4915:Olfr1080 UTSW 2 86554055 missense probably damaging 1.00
R4924:Olfr1080 UTSW 2 86553509 missense probably damaging 1.00
R4987:Olfr1080 UTSW 2 86553235 unclassified probably null 0.10
R5774:Olfr1080 UTSW 2 86554007 missense possibly damaging 0.68
R6305:Olfr1080 UTSW 2 86553495 missense possibly damaging 0.91
R6829:Olfr1080 UTSW 2 86553269 nonsense probably null
R7152:Olfr1080 UTSW 2 86553329 missense probably benign 0.14
R7561:Olfr1080 UTSW 2 86553317 missense probably benign 0.45
R8031:Olfr1080 UTSW 2 86554103 missense probably damaging 1.00
R8177:Olfr1080 UTSW 2 86553279 missense noncoding transcript
Z1088:Olfr1080 UTSW 2 86553966 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CAGCAGAGTTCATCCTGAGAACAGC -3'
(R):5'- ATGTAGACGCCAAGCTACAGACGC -3'

Sequencing Primer
(F):5'- TCATCCTGAGAACAGCTATGAG -3'
(R):5'- GCTACAGACGCCAATGTATTTC -3'
Posted On2014-04-24