Incidental Mutation 'R1609:Cbr4'
ID176676
Institutional Source Beutler Lab
Gene Symbol Cbr4
Ensembl Gene ENSMUSG00000031641
Gene Namecarbonyl reductase 4
Synonyms
MMRRC Submission 039646-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.583) question?
Stock #R1609 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location61487734-61506694 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61503158 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 220 (Y220N)
Ref Sequence ENSEMBL: ENSMUSP00000034058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034058]
Predicted Effect probably damaging
Transcript: ENSMUST00000034058
AA Change: Y220N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034058
Gene: ENSMUSG00000031641
AA Change: Y220N

DomainStartEndE-ValueType
Pfam:adh_short 3 192 2.4e-54 PFAM
Pfam:KR 4 182 6.5e-18 PFAM
Pfam:adh_short_C2 9 233 4.4e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155442
Meta Mutation Damage Score 0.7665 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.1%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 C T 12: 83,992,856 R380C possibly damaging Het
Allc A T 12: 28,553,994 D363E probably damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
App C A 16: 85,079,949 V185L probably damaging Het
Atpif1 T C 4: 132,530,767 D47G probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Ccdc6 C A 10: 70,167,047 Q203K probably damaging Het
Cntnap2 T C 6: 46,015,330 V397A probably benign Het
Dmxl2 A G 9: 54,409,263 I1613T possibly damaging Het
Dnah14 T C 1: 181,750,177 S3020P probably damaging Het
Dnah7b T C 1: 46,352,966 L3829P probably damaging Het
Fbxw25 C T 9: 109,663,510 C53Y probably benign Het
Fndc1 G T 17: 7,772,766 H699Q unknown Het
Gnaq G A 19: 16,383,254 V314M possibly damaging Het
Gpr158 A G 2: 21,783,293 T582A possibly damaging Het
Mapk1 T C 16: 17,038,306 probably benign Het
Med1 T A 11: 98,161,170 H456L possibly damaging Het
Myo6 G A 9: 80,288,217 probably null Het
Nipbl A G 15: 8,366,664 Y142H probably damaging Het
Olfr1058 A G 2: 86,385,494 I308T probably benign Het
Olfr1080 A C 2: 86,553,605 V173G probably damaging Het
Olfr1218 A T 2: 89,055,344 F27L probably benign Het
Pgbd5 T C 8: 124,434,011 D39G probably benign Het
Pnisr G T 4: 21,871,440 G387* probably null Het
Pnpla6 T C 8: 3,517,135 L61P probably damaging Het
Prkra A T 2: 76,633,592 I242N probably benign Het
Rp1 A G 1: 4,349,201 S563P probably damaging Het
Rtp3 A G 9: 110,986,017 probably benign Het
Sema3d A G 5: 12,541,056 T301A probably damaging Het
Setmar A G 6: 108,076,115 D190G probably benign Het
Sf3b2 A G 19: 5,295,033 probably benign Het
Taf4b A G 18: 14,835,881 K692E probably damaging Het
Tktl2 A G 8: 66,512,852 E354G probably benign Het
Tspan4 A G 7: 141,491,644 T135A probably damaging Het
Vmn1r22 G T 6: 57,900,748 Y81* probably null Het
Vmn2r31 T C 7: 7,384,889 E561G probably damaging Het
Xrn1 A T 9: 95,974,893 K389N probably benign Het
Zfp277 A T 12: 40,328,720 N379K probably damaging Het
Other mutations in Cbr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Cbr4 APN 8 61503211 makesense probably null
R0498:Cbr4 UTSW 8 61495073 missense probably benign 0.00
R0637:Cbr4 UTSW 8 61490706 splice site probably benign
R4168:Cbr4 UTSW 8 61491521 intron probably benign
R4709:Cbr4 UTSW 8 61490027 missense possibly damaging 0.66
R4802:Cbr4 UTSW 8 61490079 intron probably benign
R5049:Cbr4 UTSW 8 61495204 critical splice donor site probably null
R5876:Cbr4 UTSW 8 61490593 missense possibly damaging 0.78
R6020:Cbr4 UTSW 8 61487853 missense probably benign 0.44
R7818:Cbr4 UTSW 8 61487942 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCTTTATGTTTGCCAAGAGCTGAGCC -3'
(R):5'- ACACCCTTTACAACTGGTCACACTTTG -3'

Sequencing Primer
(F):5'- TGCTAACAGTACTCTGAAGTTCC -3'
(R):5'- GATGGAATCCTTTGTAGCATCC -3'
Posted On2014-04-24