Incidental Mutation 'R1609:Tktl2'
ID176677
Institutional Source Beutler Lab
Gene Symbol Tktl2
Ensembl Gene ENSMUSG00000025519
Gene Nametransketolase-like 2
Synonyms4933401I19Rik
MMRRC Submission 039646-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.426) question?
Stock #R1609 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location66511756-66518335 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66512852 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 354 (E354G)
Ref Sequence ENSEMBL: ENSMUSP00000138388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002025] [ENSMUST00000183187]
Predicted Effect probably benign
Transcript: ENSMUST00000002025
AA Change: E354G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000002025
Gene: ENSMUSG00000025519
AA Change: E354G

DomainStartEndE-ValueType
Pfam:DXP_synthase_N 2 195 2.4e-9 PFAM
Pfam:Transketolase_N 16 281 4.6e-50 PFAM
Pfam:TPP_enzyme_C 108 250 5.9e-8 PFAM
Pfam:E1_dh 111 249 2.9e-13 PFAM
Transket_pyr 320 484 3.74e-51 SMART
Pfam:Transketolase_C 495 617 1.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183187
AA Change: E354G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000138388
Gene: ENSMUSG00000025519
AA Change: E354G

DomainStartEndE-ValueType
Pfam:DXP_synthase_N 2 197 8.2e-9 PFAM
Pfam:Transketolase_N 16 280 2.2e-86 PFAM
Pfam:TPP_enzyme_C 108 250 5.9e-8 PFAM
Pfam:E1_dh 110 251 2.1e-14 PFAM
Transket_pyr 320 484 3.74e-51 SMART
Pfam:Transketolase_C 495 617 3.4e-30 PFAM
Meta Mutation Damage Score 0.1016 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.1%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 C T 12: 83,992,856 R380C possibly damaging Het
Allc A T 12: 28,553,994 D363E probably damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
App C A 16: 85,079,949 V185L probably damaging Het
Atpif1 T C 4: 132,530,767 D47G probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Cbr4 T A 8: 61,503,158 Y220N probably damaging Het
Ccdc6 C A 10: 70,167,047 Q203K probably damaging Het
Cntnap2 T C 6: 46,015,330 V397A probably benign Het
Dmxl2 A G 9: 54,409,263 I1613T possibly damaging Het
Dnah14 T C 1: 181,750,177 S3020P probably damaging Het
Dnah7b T C 1: 46,352,966 L3829P probably damaging Het
Fbxw25 C T 9: 109,663,510 C53Y probably benign Het
Fndc1 G T 17: 7,772,766 H699Q unknown Het
Gnaq G A 19: 16,383,254 V314M possibly damaging Het
Gpr158 A G 2: 21,783,293 T582A possibly damaging Het
Mapk1 T C 16: 17,038,306 probably benign Het
Med1 T A 11: 98,161,170 H456L possibly damaging Het
Myo6 G A 9: 80,288,217 probably null Het
Nipbl A G 15: 8,366,664 Y142H probably damaging Het
Olfr1058 A G 2: 86,385,494 I308T probably benign Het
Olfr1080 A C 2: 86,553,605 V173G probably damaging Het
Olfr1218 A T 2: 89,055,344 F27L probably benign Het
Pgbd5 T C 8: 124,434,011 D39G probably benign Het
Pnisr G T 4: 21,871,440 G387* probably null Het
Pnpla6 T C 8: 3,517,135 L61P probably damaging Het
Prkra A T 2: 76,633,592 I242N probably benign Het
Rp1 A G 1: 4,349,201 S563P probably damaging Het
Rtp3 A G 9: 110,986,017 probably benign Het
Sema3d A G 5: 12,541,056 T301A probably damaging Het
Setmar A G 6: 108,076,115 D190G probably benign Het
Sf3b2 A G 19: 5,295,033 probably benign Het
Taf4b A G 18: 14,835,881 K692E probably damaging Het
Tspan4 A G 7: 141,491,644 T135A probably damaging Het
Vmn1r22 G T 6: 57,900,748 Y81* probably null Het
Vmn2r31 T C 7: 7,384,889 E561G probably damaging Het
Xrn1 A T 9: 95,974,893 K389N probably benign Het
Zfp277 A T 12: 40,328,720 N379K probably damaging Het
Other mutations in Tktl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Tktl2 APN 8 66512896 missense probably benign 0.00
IGL02444:Tktl2 APN 8 66513361 missense possibly damaging 0.60
IGL02798:Tktl2 APN 8 66513311 missense probably benign 0.06
IGL02938:Tktl2 APN 8 66512330 missense probably damaging 1.00
IGL03095:Tktl2 APN 8 66512284 missense probably damaging 1.00
R0530:Tktl2 UTSW 8 66513179 missense probably damaging 0.99
R0899:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R0900:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R1080:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R1419:Tktl2 UTSW 8 66513038 missense probably damaging 0.97
R1717:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R1718:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R1719:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R1848:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R1933:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R1934:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R2134:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R2135:Tktl2 UTSW 8 66512347 missense probably damaging 0.98
R2314:Tktl2 UTSW 8 66513143 missense probably damaging 1.00
R2509:Tktl2 UTSW 8 66512852 missense probably benign 0.04
R2511:Tktl2 UTSW 8 66512852 missense probably benign 0.04
R2965:Tktl2 UTSW 8 66512063 missense probably benign 0.01
R3084:Tktl2 UTSW 8 66513206 missense possibly damaging 0.88
R3085:Tktl2 UTSW 8 66513206 missense possibly damaging 0.88
R3121:Tktl2 UTSW 8 66512156 missense probably damaging 0.98
R3499:Tktl2 UTSW 8 66513245 missense probably damaging 0.97
R4227:Tktl2 UTSW 8 66513699 splice site probably null
R4284:Tktl2 UTSW 8 66513156 missense probably damaging 1.00
R4491:Tktl2 UTSW 8 66512012 missense probably damaging 0.96
R5478:Tktl2 UTSW 8 66513398 missense probably damaging 0.99
R5801:Tktl2 UTSW 8 66513647 missense probably benign 0.00
R6656:Tktl2 UTSW 8 66512729 missense probably benign
R6864:Tktl2 UTSW 8 66512339 missense probably damaging 1.00
R6915:Tktl2 UTSW 8 66513035 missense probably damaging 1.00
R7168:Tktl2 UTSW 8 66513101 missense probably damaging 1.00
R7442:Tktl2 UTSW 8 66512909 missense possibly damaging 0.95
R7617:Tktl2 UTSW 8 66512999 missense probably benign 0.07
R7687:Tktl2 UTSW 8 66513101 missense probably damaging 1.00
RF006:Tktl2 UTSW 8 66512852 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AATAAGCCTACTGCCCTGATTGCC -3'
(R):5'- AGGTCCGTCTTCTCCAACAGACAC -3'

Sequencing Primer
(F):5'- ACCTTCAAGGGTAGAGGTATTCC -3'
(R):5'- CCGCAGTGGGAACCAAC -3'
Posted On2014-04-24