Incidental Mutation 'R1609:Fndc1'
ID176696
Institutional Source Beutler Lab
Gene Symbol Fndc1
Ensembl Gene ENSMUSG00000071984
Gene Namefibronectin type III domain containing 1
Synonyms1110027O12Rik
MMRRC Submission 039646-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R1609 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location7738569-7827302 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 7772766 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 699 (H699Q)
Ref Sequence ENSEMBL: ENSMUSP00000095036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097425]
Predicted Effect unknown
Transcript: ENSMUST00000097425
AA Change: H699Q
SMART Domains Protein: ENSMUSP00000095036
Gene: ENSMUSG00000071984
AA Change: H699Q

DomainStartEndE-ValueType
Blast:FN3 1 50 6e-25 BLAST
FN3 54 137 7.82e-4 SMART
FN3 156 240 1.48e-4 SMART
FN3 256 340 3.67e-9 SMART
low complexity region 377 388 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 646 676 N/A INTRINSIC
low complexity region 766 777 N/A INTRINSIC
low complexity region 868 884 N/A INTRINSIC
low complexity region 1021 1027 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
low complexity region 1076 1090 N/A INTRINSIC
Blast:FN3 1227 1276 2e-18 BLAST
low complexity region 1277 1354 N/A INTRINSIC
low complexity region 1395 1403 N/A INTRINSIC
low complexity region 1407 1423 N/A INTRINSIC
FN3 1494 1577 4.32e-6 SMART
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.1%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 C T 12: 83,992,856 R380C possibly damaging Het
Allc A T 12: 28,553,994 D363E probably damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
App C A 16: 85,079,949 V185L probably damaging Het
Atpif1 T C 4: 132,530,767 D47G probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Cbr4 T A 8: 61,503,158 Y220N probably damaging Het
Ccdc6 C A 10: 70,167,047 Q203K probably damaging Het
Cntnap2 T C 6: 46,015,330 V397A probably benign Het
Dmxl2 A G 9: 54,409,263 I1613T possibly damaging Het
Dnah14 T C 1: 181,750,177 S3020P probably damaging Het
Dnah7b T C 1: 46,352,966 L3829P probably damaging Het
Fbxw25 C T 9: 109,663,510 C53Y probably benign Het
Gnaq G A 19: 16,383,254 V314M possibly damaging Het
Gpr158 A G 2: 21,783,293 T582A possibly damaging Het
Mapk1 T C 16: 17,038,306 probably benign Het
Med1 T A 11: 98,161,170 H456L possibly damaging Het
Myo6 G A 9: 80,288,217 probably null Het
Nipbl A G 15: 8,366,664 Y142H probably damaging Het
Olfr1058 A G 2: 86,385,494 I308T probably benign Het
Olfr1080 A C 2: 86,553,605 V173G probably damaging Het
Olfr1218 A T 2: 89,055,344 F27L probably benign Het
Pgbd5 T C 8: 124,434,011 D39G probably benign Het
Pnisr G T 4: 21,871,440 G387* probably null Het
Pnpla6 T C 8: 3,517,135 L61P probably damaging Het
Prkra A T 2: 76,633,592 I242N probably benign Het
Rp1 A G 1: 4,349,201 S563P probably damaging Het
Rtp3 A G 9: 110,986,017 probably benign Het
Sema3d A G 5: 12,541,056 T301A probably damaging Het
Setmar A G 6: 108,076,115 D190G probably benign Het
Sf3b2 A G 19: 5,295,033 probably benign Het
Taf4b A G 18: 14,835,881 K692E probably damaging Het
Tktl2 A G 8: 66,512,852 E354G probably benign Het
Tspan4 A G 7: 141,491,644 T135A probably damaging Het
Vmn1r22 G T 6: 57,900,748 Y81* probably null Het
Vmn2r31 T C 7: 7,384,889 E561G probably damaging Het
Xrn1 A T 9: 95,974,893 K389N probably benign Het
Zfp277 A T 12: 40,328,720 N379K probably damaging Het
Other mutations in Fndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Fndc1 APN 17 7765254 missense unknown
IGL00590:Fndc1 APN 17 7765101 missense unknown
IGL00765:Fndc1 APN 17 7772693 missense unknown
IGL00904:Fndc1 APN 17 7756363 missense probably benign 0.35
IGL01153:Fndc1 APN 17 7780042 critical splice donor site probably null
IGL01557:Fndc1 APN 17 7756389 missense probably damaging 0.99
IGL02493:Fndc1 APN 17 7775545 missense unknown
IGL02501:Fndc1 APN 17 7765398 missense unknown
IGL02503:Fndc1 APN 17 7771516 missense unknown
IGL02887:Fndc1 APN 17 7773638 missense unknown
IGL03348:Fndc1 APN 17 7772647 missense unknown
pinnacle UTSW 17 7773322 missense unknown
spire UTSW 17 7771480 missense unknown
IGL02988:Fndc1 UTSW 17 7753523 missense possibly damaging 0.95
PIT4466001:Fndc1 UTSW 17 7750374 missense probably damaging 1.00
R0336:Fndc1 UTSW 17 7765107 missense unknown
R0403:Fndc1 UTSW 17 7753723 missense probably damaging 1.00
R0403:Fndc1 UTSW 17 7775588 intron probably null
R0538:Fndc1 UTSW 17 7784341 splice site probably benign
R0646:Fndc1 UTSW 17 7741673 missense possibly damaging 0.92
R1140:Fndc1 UTSW 17 7775426 missense unknown
R1523:Fndc1 UTSW 17 7773209 missense unknown
R1632:Fndc1 UTSW 17 7773200 missense unknown
R1888:Fndc1 UTSW 17 7771789 missense unknown
R1888:Fndc1 UTSW 17 7771789 missense unknown
R2004:Fndc1 UTSW 17 7804929 missense probably damaging 1.00
R2007:Fndc1 UTSW 17 7778748 unclassified probably benign
R2128:Fndc1 UTSW 17 7778665 unclassified probably benign
R2187:Fndc1 UTSW 17 7741772 missense probably damaging 1.00
R2251:Fndc1 UTSW 17 7753607 missense probably damaging 1.00
R2322:Fndc1 UTSW 17 7789015 missense probably damaging 0.98
R2425:Fndc1 UTSW 17 7805018 missense probably damaging 1.00
R2921:Fndc1 UTSW 17 7804875 missense probably damaging 0.98
R2985:Fndc1 UTSW 17 7756323 missense possibly damaging 0.93
R3436:Fndc1 UTSW 17 7750357 missense probably damaging 0.99
R3499:Fndc1 UTSW 17 7753584 missense possibly damaging 0.70
R3508:Fndc1 UTSW 17 7765108 nonsense probably null
R3766:Fndc1 UTSW 17 7784421 missense probably damaging 1.00
R3813:Fndc1 UTSW 17 7773322 missense unknown
R3814:Fndc1 UTSW 17 7773322 missense unknown
R4031:Fndc1 UTSW 17 7769752 nonsense probably null
R4544:Fndc1 UTSW 17 7773544 missense unknown
R4583:Fndc1 UTSW 17 7739249 missense probably damaging 1.00
R4619:Fndc1 UTSW 17 7765204 missense unknown
R4700:Fndc1 UTSW 17 7771480 missense unknown
R4743:Fndc1 UTSW 17 7772279 nonsense probably null
R4803:Fndc1 UTSW 17 7753706 missense probably damaging 0.98
R4862:Fndc1 UTSW 17 7769735 missense unknown
R4876:Fndc1 UTSW 17 7771639 missense unknown
R5057:Fndc1 UTSW 17 7771970 nonsense probably null
R5327:Fndc1 UTSW 17 7772708 missense unknown
R5372:Fndc1 UTSW 17 7765210 missense unknown
R5533:Fndc1 UTSW 17 7772776 missense unknown
R5754:Fndc1 UTSW 17 7769753 missense unknown
R5762:Fndc1 UTSW 17 7771534 missense unknown
R5830:Fndc1 UTSW 17 7789086 missense possibly damaging 0.87
R5924:Fndc1 UTSW 17 7773610 missense unknown
R6147:Fndc1 UTSW 17 7753762 splice site probably null
R6175:Fndc1 UTSW 17 7772647 missense unknown
R6303:Fndc1 UTSW 17 7758485 missense probably damaging 0.98
R6377:Fndc1 UTSW 17 7769735 missense unknown
R6704:Fndc1 UTSW 17 7771810 missense unknown
R6857:Fndc1 UTSW 17 7772170 missense unknown
R6865:Fndc1 UTSW 17 7772840 missense unknown
R7069:Fndc1 UTSW 17 7769735 missense unknown
R7153:Fndc1 UTSW 17 7801645 missense probably damaging 1.00
R7159:Fndc1 UTSW 17 7800931 missense probably damaging 0.97
R7359:Fndc1 UTSW 17 7813486 intron probably null
R7731:Fndc1 UTSW 17 7773439 missense unknown
R7743:Fndc1 UTSW 17 7765137 missense unknown
Z1088:Fndc1 UTSW 17 7782479 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGAAGTGGCTCTTCATCCTCACC -3'
(R):5'- TTCCACCAGCGAGGAAGATTCCAG -3'

Sequencing Primer
(F):5'- CATCTCCATAGACATCAGAGCCAG -3'
(R):5'- TCTAGGGATCGCCAGGATG -3'
Posted On2014-04-24