Incidental Mutation 'R1609:Gnaq'
ID176700
Institutional Source Beutler Lab
Gene Symbol Gnaq
Ensembl Gene ENSMUSG00000024639
Gene Nameguanine nucleotide binding protein, alpha q polypeptide
SynonymsGqI, Galphaq, Dsk10, G alpha q, 6230401I02Rik, Dsk1, Gq, 1110005L02Rik
MMRRC Submission 039646-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1609 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location16132831-16387463 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 16383254 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 314 (V314M)
Ref Sequence ENSEMBL: ENSMUSP00000025541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025541]
PDB Structure
Crystal Structure of G Protein-Coupled Receptor Kinase 2 in Complex with Galpha-q and Gbetagamma Subunits [X-RAY DIFFRACTION]
Crystal Structure of p63RhoGEF complex with Galpha-q and RhoA [X-RAY DIFFRACTION]
Structure of heterotrimeric G protein Galpha-q beta gamma in complex with an inhibitor YM-254890 [X-RAY DIFFRACTION]
Crystal structure of activated G alpha Q bound to its effector phospholipase C beta 3 [X-RAY DIFFRACTION]
Structure of human regulator of G protein signaling 2 (RGS2) in complex with murine Galpha-q(R183C) [X-RAY DIFFRACTION]
Structure of human regulator of G protein signaling 2 (RGS2) in complex with murine Galpha-q(R183C) [X-RAY DIFFRACTION]
Crystal structure of Galphaq in complex with full-length human PLCbeta3 [X-RAY DIFFRACTION]
Structure of a fragment of human phospholipase C-beta3 delta472-559, in complex with Galphaq [X-RAY DIFFRACTION]
Structure of a fragment of human phospholipase C-beta3 delta472-569, bound to IP3 and in complex with Galphaq [X-RAY DIFFRACTION]
Structure of a fragment of human phospholipase C-beta3 delta472-581, bound to IP3 and in complex with Galphaq [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025541
AA Change: V314M

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025541
Gene: ENSMUSG00000024639
AA Change: V314M

DomainStartEndE-ValueType
G_alpha 19 358 1.24e-216 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.1%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a guanine nucleotide-binding protein. The encoded protein, an alpha subunit in the Gq class, couples a seven-transmembrane domain receptor to activation of phospolipase C-beta. Mutations at this locus have been associated with problems in platelet activation and aggregation. A related pseudogene exists on chromosome 2.[provided by RefSeq, Nov 2010]
PHENOTYPE: Mutant mice exhibit pigmentation anomalies affecting the ears, tail and footpads. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 C T 12: 83,992,856 R380C possibly damaging Het
Allc A T 12: 28,553,994 D363E probably damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
App C A 16: 85,079,949 V185L probably damaging Het
Atpif1 T C 4: 132,530,767 D47G probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Cbr4 T A 8: 61,503,158 Y220N probably damaging Het
Ccdc6 C A 10: 70,167,047 Q203K probably damaging Het
Cntnap2 T C 6: 46,015,330 V397A probably benign Het
Dmxl2 A G 9: 54,409,263 I1613T possibly damaging Het
Dnah14 T C 1: 181,750,177 S3020P probably damaging Het
Dnah7b T C 1: 46,352,966 L3829P probably damaging Het
Fbxw25 C T 9: 109,663,510 C53Y probably benign Het
Fndc1 G T 17: 7,772,766 H699Q unknown Het
Gpr158 A G 2: 21,783,293 T582A possibly damaging Het
Mapk1 T C 16: 17,038,306 probably benign Het
Med1 T A 11: 98,161,170 H456L possibly damaging Het
Myo6 G A 9: 80,288,217 probably null Het
Nipbl A G 15: 8,366,664 Y142H probably damaging Het
Olfr1058 A G 2: 86,385,494 I308T probably benign Het
Olfr1080 A C 2: 86,553,605 V173G probably damaging Het
Olfr1218 A T 2: 89,055,344 F27L probably benign Het
Pgbd5 T C 8: 124,434,011 D39G probably benign Het
Pnisr G T 4: 21,871,440 G387* probably null Het
Pnpla6 T C 8: 3,517,135 L61P probably damaging Het
Prkra A T 2: 76,633,592 I242N probably benign Het
Rp1 A G 1: 4,349,201 S563P probably damaging Het
Rtp3 A G 9: 110,986,017 probably benign Het
Sema3d A G 5: 12,541,056 T301A probably damaging Het
Setmar A G 6: 108,076,115 D190G probably benign Het
Sf3b2 A G 19: 5,295,033 probably benign Het
Taf4b A G 18: 14,835,881 K692E probably damaging Het
Tktl2 A G 8: 66,512,852 E354G probably benign Het
Tspan4 A G 7: 141,491,644 T135A probably damaging Het
Vmn1r22 G T 6: 57,900,748 Y81* probably null Het
Vmn2r31 T C 7: 7,384,889 E561G probably damaging Het
Xrn1 A T 9: 95,974,893 K389N probably benign Het
Zfp277 A T 12: 40,328,720 N379K probably damaging Het
Other mutations in Gnaq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01967:Gnaq APN 19 16378160 missense probably damaging 1.00
IGL02297:Gnaq APN 19 16378251 missense probably damaging 1.00
IGL02400:Gnaq APN 19 16316128 missense probably damaging 1.00
IGL03073:Gnaq APN 19 16316106 missense probably benign 0.18
R0542:Gnaq UTSW 19 16219618 missense probably damaging 0.99
R0800:Gnaq UTSW 19 16335064 missense probably damaging 1.00
R1368:Gnaq UTSW 19 16378287 missense probably benign
R4569:Gnaq UTSW 19 16335006 missense probably damaging 1.00
R5123:Gnaq UTSW 19 16332085 missense probably benign
R5360:Gnaq UTSW 19 16133426 missense probably benign 0.01
R6384:Gnaq UTSW 19 16316013 splice site probably null
R8251:Gnaq UTSW 19 16335055 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGTGCAAGCATAAGGCAATGCAAAC -3'
(R):5'- TACTACAGCTCTGTGGACACGCTC -3'

Sequencing Primer
(F):5'- GGCAATGCAAACTAGTGCATATC -3'
(R):5'- TGGACACGCTCACAGAGTC -3'
Posted On2014-04-24