Mutagenetix > Incidental Mutation

Incidental Mutation 'R1610:Hc'

176709

Institutional Source

Beutler Lab

Gene Symbol

Ensembl Gene

ENSMUSG00000026874

Gene Name

hemolytic complement

Synonyms

He, C5, C5a

MMRRC Submission

039647-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.580) question?

Stock #

R1610 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

34983331-35061438 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 35006161 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1203 (D1203E)

Ref Sequence

ENSEMBL: ENSMUSP00000028233 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028233]

AlphaFold

P06684

PDB Structure

Crystal structure of the mouse C5a anaphylatoxin [X-RAY DIFFRACTION]
Crystal structure of the mouse C5a-desArg anaphylatoxin [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000028233
AA Change: D1203E

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000028233
Gene: ENSMUSG00000026874
AA Change: D1203E

Domain	Start	End	E-Value	Type
Pfam:A2M_N	125	219	1.8e-15	PFAM
A2M_N_2	465	612	9.83e-34	SMART
ANATO	702	736	4.73e-12	SMART
A2M	776	863	2.44e-29	SMART
Pfam:A2M_comp	1055	1306	2.3e-68	PFAM
A2M_recep	1423	1513	7.29e-28	SMART
C345C	1553	1665	1.51e-35	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151628

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153559

Predicted Effect

probably benign
Transcript: ENSMUST00000156412

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a component of the complement system, a part of the innate immune system that plays an important role in inflammation, host homeostasis, and host defense against pathogens. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the C5 alpha chain, C5 beta chain, C5a anaphylatoxin and C5b. The C5 protein is comprised of the alpha and beta chains, which are linked by a disulfide bridge. Cleavage of the alpha chain by a convertase enzyme results in the formation of the C5a anaphylatoxin, which possesses potent spasmogenic and chemotactic activity, and the C5b macromolecular cleavage product, a subunit of the membrane attack complex (MAC). Mice with a homozygous mutation in this gene exhibit impaired bone fracture healing and an enhanced inflammatory response in an allergic lung disease model. [provided by RefSeq, Nov 2015]
PHENOTYPE: Macrophage from mice homozygous for disruptions of this gene do not secrete complement C5.

The 2 bp deletion found in A/J and AKR/J strains is associated with susceptibility to allergen-induced bronchial hyperresponsiveness and is a candidate for QTL Abhr2.

[provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	G	T	6: 96,165,289	P258Q	probably damaging	Het
4930452B06Rik	G	T	14: 8,511,110	H435N	probably benign	Het
Acbd5	G	A	2: 23,090,551	C312Y	probably damaging	Het
Adgrl1	T	A	8: 83,932,373	M601K	probably benign	Het
Agbl4	G	A	4: 111,657,168	E459K	probably benign	Het
Anxa2	TCCC	TCC	9: 69,489,754		probably null	Het
Casz1	C	T	4: 148,929,087	A36V	possibly damaging	Het
Chpf	A	G	1: 75,476,648	V327A	probably damaging	Het
Cldn23	A	G	8: 35,825,930	Y135H	probably damaging	Het
Cobll1	C	T	2: 65,133,642	D211N	probably damaging	Het
Cramp1l	A	G	17: 24,983,951	V368A	probably benign	Het
Dnah6	T	C	6: 73,144,963	T1374A	probably benign	Het
Dpyd	A	G	3: 119,065,006	H623R	probably benign	Het
Dyrk2	T	C	10: 118,859,925	N476S	probably benign	Het
Endog	A	T	2: 30,173,887	I267F	probably damaging	Het
Ephb6	A	T	6: 41,614,373	K155*	probably null	Het
Far2	T	C	6: 148,157,458	V214A	possibly damaging	Het
Fat2	A	G	11: 55,278,924	V3003A	probably damaging	Het
Frg2f1	T	A	4: 119,531,288	T5S	possibly damaging	Het
Gm14496	A	T	2: 181,996,179	T349S	probably benign	Het
Golgb1	A	G	16: 36,926,101	T2951A	probably benign	Het
Isg20	C	A	7: 78,914,509	Q55K	possibly damaging	Het
Jph4	G	T	14: 55,114,103	A152E	probably damaging	Het
Kcnq3	T	C	15: 66,025,260	T264A	probably damaging	Het
Kcnq5	T	G	1: 21,457,461	T463P	probably damaging	Het
Klra8	A	G	6: 130,119,018	S204P	probably damaging	Het
Ldlrad1	A	G	4: 107,214,875	D98G	probably damaging	Het
Lhfpl4	T	C	6: 113,194,136	T30A	possibly damaging	Het
Lig1	T	A	7: 13,285,340	L80Q	probably damaging	Het
Lmbrd2	A	G	15: 9,186,612	Y558C	probably benign	Het
Lrrn3	G	T	12: 41,452,993	L442I	possibly damaging	Het
Mc2r	A	G	18: 68,407,448	F258S	probably damaging	Het
Mmp16	A	G	4: 18,011,582	T137A	probably benign	Het
Nfatc2ip	A	T	7: 126,387,407	S359T	probably damaging	Het
Nup214	C	T	2: 32,034,466	S1669F	probably damaging	Het
Olfr1193	A	T	2: 88,678,574	K233*	probably null	Het
Olfr1229	T	C	2: 89,282,821	H104R	probably damaging	Het
Olfr514	T	A	7: 108,825,924	H25L	probably benign	Het
Olfr904	C	T	9: 38,464,631	L197F	probably damaging	Het
Plagl1	C	T	10: 13,128,962		probably benign	Het
Plxnb2	A	T	15: 89,158,493	S1531T	probably damaging	Het
Ptpn22	G	A	3: 103,902,196		probably null	Het
Rtn1	T	A	12: 72,219,279	Q174L	possibly damaging	Het
Selenoo	A	G	15: 89,099,916	E645G	probably benign	Het
Serpina1a	A	C	12: 103,853,837	D383E	possibly damaging	Het
Slc6a18	T	A	13: 73,668,225	Y345F	probably benign	Het
Smbd1	A	G	16: 32,806,765	V51A	possibly damaging	Het
Tchh	C	T	3: 93,444,839	R529W	unknown	Het
Tmem206	A	G	1: 191,345,065	D195G	probably benign	Het
Tonsl	A	T	15: 76,638,557	Y165N	probably damaging	Het
Trdmt1	G	A	2: 13,516,059	T344I	probably damaging	Het
Ubash3b	C	A	9: 41,043,500	R116L	probably damaging	Het
Vmn2r94	A	G	17: 18,243,733	V765A	probably damaging	Het
Zfp474	C	T	18: 52,638,365	T30I	probably benign	Het

Other mutations in Hc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00694:Hc	APN	2	34991629	missense	probably benign	0.00
IGL00922:Hc	APN	2	34991668	missense	probably damaging	1.00
IGL01523:Hc	APN	2	35039238	missense	probably benign	0.04
IGL01746:Hc	APN	2	35057326	missense	probably damaging	0.98
IGL01793:Hc	APN	2	35028190	missense	probably damaging	1.00
IGL01972:Hc	APN	2	34983772	missense	probably damaging	1.00
IGL02037:Hc	APN	2	35013519	missense	probably benign	0.16
IGL02048:Hc	APN	2	34996027	missense	probably benign	0.00
IGL02227:Hc	APN	2	35009911	intron	probably benign
IGL02230:Hc	APN	2	35013670	missense	probably benign
IGL02254:Hc	APN	2	34984824	missense	probably damaging	1.00
IGL02363:Hc	APN	2	35000835	missense	probably benign
IGL02650:Hc	APN	2	35000874	missense	possibly damaging	0.49
IGL03053:Hc	APN	2	35024198	missense	probably benign	0.07
IGL03168:Hc	APN	2	35024198	missense	probably benign	0.07
IGL03341:Hc	APN	2	35003377	missense	probably damaging	0.98
PIT4142001:Hc	UTSW	2	35031821	splice site	probably benign
PIT4378001:Hc	UTSW	2	35031864	missense	probably benign	0.13
PIT4508001:Hc	UTSW	2	34984804	missense	probably damaging	0.96
PIT4812001:Hc	UTSW	2	35029452	missense	probably benign	0.16
R0025:Hc	UTSW	2	34986292	missense	probably damaging	1.00
R0053:Hc	UTSW	2	35057275	missense	probably benign	0.32
R0197:Hc	UTSW	2	34984750	missense	probably damaging	1.00
R0218:Hc	UTSW	2	35028074	missense	probably damaging	1.00
R0242:Hc	UTSW	2	35036154	splice site	probably benign
R0496:Hc	UTSW	2	35013571	missense	probably damaging	1.00
R1205:Hc	UTSW	2	35003524	missense	possibly damaging	0.50
R1468:Hc	UTSW	2	34983807	nonsense	probably null
R1468:Hc	UTSW	2	34983807	nonsense	probably null
R1574:Hc	UTSW	2	35000765	intron	probably benign
R1640:Hc	UTSW	2	35057324	nonsense	probably null
R1887:Hc	UTSW	2	35034611	missense	probably benign
R1920:Hc	UTSW	2	35029395	splice site	probably benign
R2018:Hc	UTSW	2	35013528	missense	probably damaging	1.00
R2019:Hc	UTSW	2	35013528	missense	probably damaging	1.00
R2151:Hc	UTSW	2	34991103	intron	probably benign
R2366:Hc	UTSW	2	35013636	missense	probably benign
R4093:Hc	UTSW	2	34983807	nonsense	probably null
R4288:Hc	UTSW	2	35030402	missense	probably damaging	0.98
R4501:Hc	UTSW	2	34997476	splice site	probably null
R4502:Hc	UTSW	2	35006252	missense	probably benign	0.00
R4508:Hc	UTSW	2	35013065	missense	possibly damaging	0.94
R4583:Hc	UTSW	2	35028177	missense	probably benign	0.00
R4686:Hc	UTSW	2	35039248	missense	possibly damaging	0.49
R4776:Hc	UTSW	2	35039734	missense	probably benign	0.12
R4846:Hc	UTSW	2	35019670	missense	probably benign	0.00
R5032:Hc	UTSW	2	35013532	missense	probably benign	0.07
R5089:Hc	UTSW	2	35024890	missense	probably benign	0.01
R5289:Hc	UTSW	2	34996014	critical splice donor site	probably null
R5347:Hc	UTSW	2	35037624	missense	probably benign	0.04
R5356:Hc	UTSW	2	34994995	missense	probably benign	0.00
R5379:Hc	UTSW	2	34991065	missense	probably damaging	1.00
R5403:Hc	UTSW	2	35057434	missense	probably damaging	1.00
R5418:Hc	UTSW	2	35008183	critical splice donor site	probably null
R5450:Hc	UTSW	2	35013038	missense	possibly damaging	0.67
R5494:Hc	UTSW	2	35003539	splice site	probably null
R5713:Hc	UTSW	2	35013531	missense	probably damaging	0.99
R5898:Hc	UTSW	2	34997437	missense	probably benign	0.06
R5925:Hc	UTSW	2	35030450	missense	possibly damaging	0.92
R5942:Hc	UTSW	2	35028125	nonsense	probably null
R5991:Hc	UTSW	2	35006105	missense	possibly damaging	0.91
R6036:Hc	UTSW	2	35039684	missense	probably benign	0.00
R6036:Hc	UTSW	2	35039684	missense	probably benign	0.00
R6115:Hc	UTSW	2	35013038	missense	probably damaging	1.00
R6234:Hc	UTSW	2	35028046	missense	probably benign
R6264:Hc	UTSW	2	35006273	critical splice acceptor site	probably null
R6313:Hc	UTSW	2	34989839	splice site	probably null
R6525:Hc	UTSW	2	34991224	missense	probably benign	0.06
R6577:Hc	UTSW	2	35032126	missense	probably benign	0.00
R6601:Hc	UTSW	2	35045894	missense	probably benign	0.03
R6916:Hc	UTSW	2	35010032	nonsense	probably null
R7108:Hc	UTSW	2	35039694	missense	probably benign	0.03
R7143:Hc	UTSW	2	35050438	missense	probably benign	0.00
R7388:Hc	UTSW	2	34984847	splice site	probably null
R7468:Hc	UTSW	2	35028051	missense	probably benign	0.00
R7504:Hc	UTSW	2	35061319	missense	not run
R7521:Hc	UTSW	2	35045332	missense	possibly damaging	0.80
R7582:Hc	UTSW	2	34991266	missense	possibly damaging	0.70
R7596:Hc	UTSW	2	35000847	missense	probably damaging	0.96
R7599:Hc	UTSW	2	35050419	missense	probably damaging	1.00
R7692:Hc	UTSW	2	35024149	missense	probably damaging	1.00
R7853:Hc	UTSW	2	35010033	missense	probably damaging	1.00
R7877:Hc	UTSW	2	34997399	nonsense	probably null
R8329:Hc	UTSW	2	35012898	splice site	probably null
R8375:Hc	UTSW	2	34983719	missense	probably benign	0.32
R8477:Hc	UTSW	2	34989170	missense	probably damaging	1.00
R8810:Hc	UTSW	2	35019523	missense	probably benign	0.06
R8888:Hc	UTSW	2	35000849	missense	probably benign	0.00
R8895:Hc	UTSW	2	35000849	missense	probably benign	0.00
R8968:Hc	UTSW	2	35032305	missense	possibly damaging	0.91
R8969:Hc	UTSW	2	35019463	critical splice donor site	probably null
R9146:Hc	UTSW	2	35034559	missense	probably damaging	1.00
R9218:Hc	UTSW	2	35032191	missense	probably damaging	1.00
R9340:Hc	UTSW	2	34986282	missense	probably damaging	0.99
R9396:Hc	UTSW	2	35037603	nonsense	probably null
R9569:Hc	UTSW	2	35036347	missense	probably benign	0.00
R9576:Hc	UTSW	2	34983755	missense	probably benign	0.01
R9706:Hc	UTSW	2	35024184	missense	probably damaging	1.00
X0066:Hc	UTSW	2	34983711	missense	probably damaging	1.00
Z1088:Hc	UTSW	2	35008249	missense	possibly damaging	0.94
Z1088:Hc	UTSW	2	35029470	missense	probably benign	0.02
Z1176:Hc	UTSW	2	35006273	critical splice acceptor site	probably null
Z1177:Hc	UTSW	2	35013610	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGCAAGTATGCCATCTTCCTCTG -3'
(R):5'- TGACAAAGCATAGGCCAAACTGGAC -3'

Sequencing Primer
(F):5'- TCTGCTTTCATTGCAACCAC -3'
(R):5'- CTAcaccccaccccacc -3'

Posted On

2014-04-24