Incidental Mutation 'R1610:Hc'
ID176709
Institutional Source Beutler Lab
Gene Symbol Hc
Ensembl Gene ENSMUSG00000026874
Gene Namehemolytic complement
SynonymsHe, C5, C5a
MMRRC Submission 039647-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.736) question?
Stock #R1610 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location34983331-35061438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 35006161 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1203 (D1203E)
Ref Sequence ENSEMBL: ENSMUSP00000028233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028233]
PDB Structure Crystal structure of the mouse C5a anaphylatoxin [X-RAY DIFFRACTION]
Crystal structure of the mouse C5a-desArg anaphylatoxin [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028233
AA Change: D1203E

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028233
Gene: ENSMUSG00000026874
AA Change: D1203E

DomainStartEndE-ValueType
Pfam:A2M_N 125 219 1.8e-15 PFAM
A2M_N_2 465 612 9.83e-34 SMART
ANATO 702 736 4.73e-12 SMART
A2M 776 863 2.44e-29 SMART
Pfam:A2M_comp 1055 1306 2.3e-68 PFAM
A2M_recep 1423 1513 7.29e-28 SMART
C345C 1553 1665 1.51e-35 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153559
Predicted Effect probably benign
Transcript: ENSMUST00000156412
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a component of the complement system, a part of the innate immune system that plays an important role in inflammation, host homeostasis, and host defense against pathogens. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the C5 alpha chain, C5 beta chain, C5a anaphylatoxin and C5b. The C5 protein is comprised of the alpha and beta chains, which are linked by a disulfide bridge. Cleavage of the alpha chain by a convertase enzyme results in the formation of the C5a anaphylatoxin, which possesses potent spasmogenic and chemotactic activity, and the C5b macromolecular cleavage product, a subunit of the membrane attack complex (MAC). Mice with a homozygous mutation in this gene exhibit impaired bone fracture healing and an enhanced inflammatory response in an allergic lung disease model. [provided by RefSeq, Nov 2015]
PHENOTYPE: Macrophage from mice homozygous for disruptions of this gene do not secrete complement C5.

The 2 bp deletion found in A/J and AKR/J strains is associated with susceptibility to allergen-induced bronchial hyperresponsiveness and is a candidate for QTL Abhr2.

[provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik G T 6: 96,165,289 P258Q probably damaging Het
4930452B06Rik G T 14: 8,511,110 H435N probably benign Het
Acbd5 G A 2: 23,090,551 C312Y probably damaging Het
Adgrl1 T A 8: 83,932,373 M601K probably benign Het
Agbl4 G A 4: 111,657,168 E459K probably benign Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Casz1 C T 4: 148,929,087 A36V possibly damaging Het
Chpf A G 1: 75,476,648 V327A probably damaging Het
Cldn23 A G 8: 35,825,930 Y135H probably damaging Het
Cobll1 C T 2: 65,133,642 D211N probably damaging Het
Cramp1l A G 17: 24,983,951 V368A probably benign Het
Dnah6 T C 6: 73,144,963 T1374A probably benign Het
Dpyd A G 3: 119,065,006 H623R probably benign Het
Dyrk2 T C 10: 118,859,925 N476S probably benign Het
Endog A T 2: 30,173,887 I267F probably damaging Het
Ephb6 A T 6: 41,614,373 K155* probably null Het
Far2 T C 6: 148,157,458 V214A possibly damaging Het
Fat2 A G 11: 55,278,924 V3003A probably damaging Het
Frg2f1 T A 4: 119,531,288 T5S possibly damaging Het
Gm14496 A T 2: 181,996,179 T349S probably benign Het
Golgb1 A G 16: 36,926,101 T2951A probably benign Het
Isg20 C A 7: 78,914,509 Q55K possibly damaging Het
Jph4 G T 14: 55,114,103 A152E probably damaging Het
Kcnq3 T C 15: 66,025,260 T264A probably damaging Het
Kcnq5 T G 1: 21,457,461 T463P probably damaging Het
Klra8 A G 6: 130,119,018 S204P probably damaging Het
Ldlrad1 A G 4: 107,214,875 D98G probably damaging Het
Lhfpl4 T C 6: 113,194,136 T30A possibly damaging Het
Lig1 T A 7: 13,285,340 L80Q probably damaging Het
Lmbrd2 A G 15: 9,186,612 Y558C probably benign Het
Lrrn3 G T 12: 41,452,993 L442I possibly damaging Het
Mc2r A G 18: 68,407,448 F258S probably damaging Het
Mmp16 A G 4: 18,011,582 T137A probably benign Het
Nfatc2ip A T 7: 126,387,407 S359T probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1193 A T 2: 88,678,574 K233* probably null Het
Olfr1229 T C 2: 89,282,821 H104R probably damaging Het
Olfr514 T A 7: 108,825,924 H25L probably benign Het
Olfr904 C T 9: 38,464,631 L197F probably damaging Het
Plagl1 C T 10: 13,128,962 probably benign Het
Plxnb2 A T 15: 89,158,493 S1531T probably damaging Het
Ptpn22 G A 3: 103,902,196 probably null Het
Rtn1 T A 12: 72,219,279 Q174L possibly damaging Het
Selenoo A G 15: 89,099,916 E645G probably benign Het
Serpina1a A C 12: 103,853,837 D383E possibly damaging Het
Slc6a18 T A 13: 73,668,225 Y345F probably benign Het
Smbd1 A G 16: 32,806,765 V51A possibly damaging Het
Tchh C T 3: 93,444,839 R529W unknown Het
Tmem206 A G 1: 191,345,065 D195G probably benign Het
Tonsl A T 15: 76,638,557 Y165N probably damaging Het
Trdmt1 G A 2: 13,516,059 T344I probably damaging Het
Ubash3b C A 9: 41,043,500 R116L probably damaging Het
Vmn2r94 A G 17: 18,243,733 V765A probably damaging Het
Zfp474 C T 18: 52,638,365 T30I probably benign Het
Other mutations in Hc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Hc APN 2 34991629 missense probably benign 0.00
IGL00922:Hc APN 2 34991668 missense probably damaging 1.00
IGL01523:Hc APN 2 35039238 missense probably benign 0.04
IGL01746:Hc APN 2 35057326 missense probably damaging 0.98
IGL01793:Hc APN 2 35028190 missense probably damaging 1.00
IGL01972:Hc APN 2 34983772 missense probably damaging 1.00
IGL02037:Hc APN 2 35013519 missense probably benign 0.16
IGL02048:Hc APN 2 34996027 missense probably benign 0.00
IGL02227:Hc APN 2 35009911 intron probably benign
IGL02230:Hc APN 2 35013670 missense probably benign
IGL02254:Hc APN 2 34984824 missense probably damaging 1.00
IGL02363:Hc APN 2 35000835 missense probably benign
IGL02650:Hc APN 2 35000874 missense possibly damaging 0.49
IGL03053:Hc APN 2 35024198 missense probably benign 0.07
IGL03168:Hc APN 2 35024198 missense probably benign 0.07
IGL03341:Hc APN 2 35003377 missense probably damaging 0.98
PIT4142001:Hc UTSW 2 35031821 splice site probably benign
PIT4378001:Hc UTSW 2 35031864 missense probably benign 0.13
PIT4508001:Hc UTSW 2 34984804 missense probably damaging 0.96
PIT4812001:Hc UTSW 2 35029452 missense probably benign 0.16
R0025:Hc UTSW 2 34986292 missense probably damaging 1.00
R0053:Hc UTSW 2 35057275 missense probably benign 0.32
R0197:Hc UTSW 2 34984750 missense probably damaging 1.00
R0218:Hc UTSW 2 35028074 missense probably damaging 1.00
R0242:Hc UTSW 2 35036154 splice site probably benign
R0496:Hc UTSW 2 35013571 missense probably damaging 1.00
R1205:Hc UTSW 2 35003524 missense possibly damaging 0.50
R1468:Hc UTSW 2 34983807 nonsense probably null
R1468:Hc UTSW 2 34983807 nonsense probably null
R1574:Hc UTSW 2 35000765 intron probably benign
R1640:Hc UTSW 2 35057324 nonsense probably null
R1887:Hc UTSW 2 35034611 missense probably benign
R1920:Hc UTSW 2 35029395 splice site probably benign
R2018:Hc UTSW 2 35013528 missense probably damaging 1.00
R2019:Hc UTSW 2 35013528 missense probably damaging 1.00
R2151:Hc UTSW 2 34991103 intron probably benign
R2366:Hc UTSW 2 35013636 missense probably benign
R4093:Hc UTSW 2 34983807 nonsense probably null
R4288:Hc UTSW 2 35030402 missense probably damaging 0.98
R4501:Hc UTSW 2 34997476 splice site probably null
R4502:Hc UTSW 2 35006252 missense probably benign 0.00
R4508:Hc UTSW 2 35013065 missense possibly damaging 0.94
R4583:Hc UTSW 2 35028177 missense probably benign 0.00
R4686:Hc UTSW 2 35039248 missense possibly damaging 0.49
R4776:Hc UTSW 2 35039734 missense probably benign 0.12
R4846:Hc UTSW 2 35019670 missense probably benign 0.00
R5032:Hc UTSW 2 35013532 missense probably benign 0.07
R5089:Hc UTSW 2 35024890 missense probably benign 0.01
R5289:Hc UTSW 2 34996014 critical splice donor site probably null
R5347:Hc UTSW 2 35037624 missense probably benign 0.04
R5356:Hc UTSW 2 34994995 missense probably benign 0.00
R5379:Hc UTSW 2 34991065 missense probably damaging 1.00
R5403:Hc UTSW 2 35057434 missense probably damaging 1.00
R5418:Hc UTSW 2 35008183 critical splice donor site probably null
R5450:Hc UTSW 2 35013038 missense possibly damaging 0.67
R5494:Hc UTSW 2 35003539 splice site probably null
R5713:Hc UTSW 2 35013531 missense probably damaging 0.99
R5898:Hc UTSW 2 34997437 missense probably benign 0.06
R5925:Hc UTSW 2 35030450 missense possibly damaging 0.92
R5942:Hc UTSW 2 35028125 nonsense probably null
R5991:Hc UTSW 2 35006105 missense possibly damaging 0.91
R6036:Hc UTSW 2 35039684 missense probably benign 0.00
R6036:Hc UTSW 2 35039684 missense probably benign 0.00
R6115:Hc UTSW 2 35013038 missense probably damaging 1.00
R6234:Hc UTSW 2 35028046 missense probably benign
R6264:Hc UTSW 2 35006273 critical splice acceptor site probably null
R6313:Hc UTSW 2 34989839 splice site probably null
R6525:Hc UTSW 2 34991224 missense probably benign 0.06
R6577:Hc UTSW 2 35032126 missense probably benign 0.00
R6601:Hc UTSW 2 35045894 missense probably benign 0.03
R6916:Hc UTSW 2 35010032 nonsense probably null
R7108:Hc UTSW 2 35039694 missense probably benign 0.03
R7143:Hc UTSW 2 35050438 missense probably benign 0.00
R7388:Hc UTSW 2 34984847 splice site probably null
R7468:Hc UTSW 2 35028051 missense probably benign 0.00
R7504:Hc UTSW 2 35061319 missense not run
R7521:Hc UTSW 2 35045332 missense possibly damaging 0.80
R7582:Hc UTSW 2 34991266 missense possibly damaging 0.70
R7596:Hc UTSW 2 35000847 missense probably damaging 0.96
R7599:Hc UTSW 2 35050419 missense probably damaging 1.00
R7692:Hc UTSW 2 35024149 missense probably damaging 1.00
R7853:Hc UTSW 2 35010033 missense probably damaging 1.00
R7877:Hc UTSW 2 34997399 nonsense probably null
R8329:Hc UTSW 2 35012898 splice site probably null
R8375:Hc UTSW 2 34983719 missense probably benign 0.32
R8477:Hc UTSW 2 34989170 missense probably damaging 1.00
R8810:Hc UTSW 2 35019523 missense probably benign 0.06
R8888:Hc UTSW 2 35000849 missense probably benign 0.00
R8895:Hc UTSW 2 35000849 missense probably benign 0.00
R8968:Hc UTSW 2 35032305 missense possibly damaging 0.91
R8969:Hc UTSW 2 35019463 critical splice donor site probably null
X0066:Hc UTSW 2 34983711 missense probably damaging 1.00
Z1088:Hc UTSW 2 35008249 missense possibly damaging 0.94
Z1088:Hc UTSW 2 35029470 missense probably benign 0.02
Z1176:Hc UTSW 2 35006273 critical splice acceptor site probably null
Z1177:Hc UTSW 2 35013610 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCAAGTATGCCATCTTCCTCTG -3'
(R):5'- TGACAAAGCATAGGCCAAACTGGAC -3'

Sequencing Primer
(F):5'- TCTGCTTTCATTGCAACCAC -3'
(R):5'- CTAcaccccaccccacc -3'
Posted On2014-04-24