Mutagenetix > Incidental Mutation

Incidental Mutation 'R1610:Gm14496'

176714

Institutional Source

Beutler Lab

Gene Symbol

Gm14496

Ensembl Gene

ENSMUSG00000098505

Gene Name

predicted gene 14496

Synonyms

MMRRC Submission

039647-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1610 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

181991226-182001766 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 181996179 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 349 (T349S)

Ref Sequence

ENSEMBL: ENSMUSP00000071670 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071760]

AlphaFold

K7N5U4

Predicted Effect

probably benign
Transcript: ENSMUST00000071760
AA Change: T349S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000071670
Gene: ENSMUSG00000098505
AA Change: T349S

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:ANF_receptor	76	456	1.3e-30	PFAM
Pfam:NCD3G	508	562	1.9e-18	PFAM
Pfam:7tm_3	595	830	7.9e-55	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000089788

SMART Domains

Protein: ENSMUSP00000087221
Gene: ENSMUSG00000053277

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:ANF_receptor	76	425	2.8e-29	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184507

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	G	T	6: 96,165,289	P258Q	probably damaging	Het
4930452B06Rik	G	T	14: 8,511,110	H435N	probably benign	Het
Acbd5	G	A	2: 23,090,551	C312Y	probably damaging	Het
Adgrl1	T	A	8: 83,932,373	M601K	probably benign	Het
Agbl4	G	A	4: 111,657,168	E459K	probably benign	Het
Anxa2	TCCC	TCC	9: 69,489,754		probably null	Het
Casz1	C	T	4: 148,929,087	A36V	possibly damaging	Het
Chpf	A	G	1: 75,476,648	V327A	probably damaging	Het
Cldn23	A	G	8: 35,825,930	Y135H	probably damaging	Het
Cobll1	C	T	2: 65,133,642	D211N	probably damaging	Het
Cramp1l	A	G	17: 24,983,951	V368A	probably benign	Het
Dnah6	T	C	6: 73,144,963	T1374A	probably benign	Het
Dpyd	A	G	3: 119,065,006	H623R	probably benign	Het
Dyrk2	T	C	10: 118,859,925	N476S	probably benign	Het
Endog	A	T	2: 30,173,887	I267F	probably damaging	Het
Ephb6	A	T	6: 41,614,373	K155*	probably null	Het
Far2	T	C	6: 148,157,458	V214A	possibly damaging	Het
Fat2	A	G	11: 55,278,924	V3003A	probably damaging	Het
Frg2f1	T	A	4: 119,531,288	T5S	possibly damaging	Het
Golgb1	A	G	16: 36,926,101	T2951A	probably benign	Het
Hc	G	T	2: 35,006,161	D1203E	probably benign	Het
Isg20	C	A	7: 78,914,509	Q55K	possibly damaging	Het
Jph4	G	T	14: 55,114,103	A152E	probably damaging	Het
Kcnq3	T	C	15: 66,025,260	T264A	probably damaging	Het
Kcnq5	T	G	1: 21,457,461	T463P	probably damaging	Het
Klra8	A	G	6: 130,119,018	S204P	probably damaging	Het
Ldlrad1	A	G	4: 107,214,875	D98G	probably damaging	Het
Lhfpl4	T	C	6: 113,194,136	T30A	possibly damaging	Het
Lig1	T	A	7: 13,285,340	L80Q	probably damaging	Het
Lmbrd2	A	G	15: 9,186,612	Y558C	probably benign	Het
Lrrn3	G	T	12: 41,452,993	L442I	possibly damaging	Het
Mc2r	A	G	18: 68,407,448	F258S	probably damaging	Het
Mmp16	A	G	4: 18,011,582	T137A	probably benign	Het
Nfatc2ip	A	T	7: 126,387,407	S359T	probably damaging	Het
Nup214	C	T	2: 32,034,466	S1669F	probably damaging	Het
Olfr1193	A	T	2: 88,678,574	K233*	probably null	Het
Olfr1229	T	C	2: 89,282,821	H104R	probably damaging	Het
Olfr514	T	A	7: 108,825,924	H25L	probably benign	Het
Olfr904	C	T	9: 38,464,631	L197F	probably damaging	Het
Plagl1	C	T	10: 13,128,962		probably benign	Het
Plxnb2	A	T	15: 89,158,493	S1531T	probably damaging	Het
Ptpn22	G	A	3: 103,902,196		probably null	Het
Rtn1	T	A	12: 72,219,279	Q174L	possibly damaging	Het
Selenoo	A	G	15: 89,099,916	E645G	probably benign	Het
Serpina1a	A	C	12: 103,853,837	D383E	possibly damaging	Het
Slc6a18	T	A	13: 73,668,225	Y345F	probably benign	Het
Smbd1	A	G	16: 32,806,765	V51A	possibly damaging	Het
Tchh	C	T	3: 93,444,839	R529W	unknown	Het
Tmem206	A	G	1: 191,345,065	D195G	probably benign	Het
Tonsl	A	T	15: 76,638,557	Y165N	probably damaging	Het
Trdmt1	G	A	2: 13,516,059	T344I	probably damaging	Het
Ubash3b	C	A	9: 41,043,500	R116L	probably damaging	Het
Vmn2r94	A	G	17: 18,243,733	V765A	probably damaging	Het
Zfp474	C	T	18: 52,638,365	T30I	probably benign	Het

Other mutations in Gm14496

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01144:Gm14496	APN	2	181995021	missense	probably damaging	1.00
IGL01300:Gm14496	APN	2	182000960	missense	probably damaging	1.00
IGL01328:Gm14496	APN	2	181995880	missense	probably damaging	1.00
IGL01526:Gm14496	APN	2	181995665	missense	probably benign	0.12
IGL01576:Gm14496	APN	2	181991371	missense	possibly damaging	0.92
IGL01775:Gm14496	APN	2	182000332	missense	probably benign	0.00
IGL02020:Gm14496	APN	2	181996089	missense	possibly damaging	0.95
IGL02150:Gm14496	APN	2	181991347	missense	probably damaging	0.99
IGL02170:Gm14496	APN	2	181996351	missense	probably damaging	1.00
IGL02262:Gm14496	APN	2	181996012	missense	probably damaging	1.00
IGL02398:Gm14496	APN	2	181996170	missense	probably benign	0.09
IGL02414:Gm14496	APN	2	181991405	missense	probably benign	0.03
IGL02541:Gm14496	APN	2	182000393	missense	probably benign	0.29
IGL02741:Gm14496	APN	2	181991343	missense	probably benign
IGL02933:Gm14496	APN	2	182000463	missense	probably benign	0.15
IGL03214:Gm14496	APN	2	182000536	missense	probably damaging	1.00
FR4342:Gm14496	UTSW	2	181995906	missense	probably benign	0.01
R0158:Gm14496	UTSW	2	181997413	missense	probably benign	0.07
R0271:Gm14496	UTSW	2	181995954	missense	probably benign	0.44
R0611:Gm14496	UTSW	2	181995111	missense	probably benign	0.00
R0833:Gm14496	UTSW	2	181996266	missense	probably damaging	0.99
R0834:Gm14496	UTSW	2	181995687	missense	probably benign	0.00
R0906:Gm14496	UTSW	2	182000515	missense	probably damaging	0.98
R1298:Gm14496	UTSW	2	181996092	missense	probably benign	0.39
R1500:Gm14496	UTSW	2	181991233	missense	probably benign	0.21
R1585:Gm14496	UTSW	2	181996209	missense	possibly damaging	0.79
R1627:Gm14496	UTSW	2	181998778	missense	probably damaging	1.00
R1635:Gm14496	UTSW	2	182001044	missense	possibly damaging	0.88
R1663:Gm14496	UTSW	2	181997437	missense	probably benign	0.03
R1792:Gm14496	UTSW	2	181996153	missense	probably benign	0.00
R1888:Gm14496	UTSW	2	182000196	nonsense	probably null
R1888:Gm14496	UTSW	2	182000196	nonsense	probably null
R1922:Gm14496	UTSW	2	182001004	missense	probably benign	0.22
R2081:Gm14496	UTSW	2	182000479	missense	probably damaging	1.00
R2102:Gm14496	UTSW	2	181991334	missense	possibly damaging	0.88
R2176:Gm14496	UTSW	2	181991337	missense	probably benign
R4154:Gm14496	UTSW	2	181995079	missense	probably benign	0.01
R4789:Gm14496	UTSW	2	181995784	missense	possibly damaging	0.85
R4873:Gm14496	UTSW	2	181997433	missense	probably damaging	0.99
R4875:Gm14496	UTSW	2	181997433	missense	probably damaging	0.99
R5020:Gm14496	UTSW	2	181991359	missense	possibly damaging	0.67
R5354:Gm14496	UTSW	2	182000809	missense	probably damaging	1.00
R5361:Gm14496	UTSW	2	182000354	missense	probably benign	0.07
R5457:Gm14496	UTSW	2	181997608	missense	probably damaging	0.96
R5589:Gm14496	UTSW	2	181995881	nonsense	probably null
R5655:Gm14496	UTSW	2	181996182	missense	probably benign	0.06
R6007:Gm14496	UTSW	2	181997530	missense	probably benign	0.37
R6123:Gm14496	UTSW	2	181991227	start codon destroyed	probably null	1.00
R6159:Gm14496	UTSW	2	181996257	missense	probably benign	0.01
R6168:Gm14496	UTSW	2	182000957	missense	probably damaging	1.00
R6454:Gm14496	UTSW	2	181996222	missense	probably damaging	0.97
R6502:Gm14496	UTSW	2	182000593	missense	probably benign	0.01
R6649:Gm14496	UTSW	2	181997476	missense	possibly damaging	0.83
R6996:Gm14496	UTSW	2	181996204	missense	probably damaging	1.00
R7043:Gm14496	UTSW	2	182000327	missense	possibly damaging	0.70
R7317:Gm14496	UTSW	2	181995820	missense	possibly damaging	0.56
R7354:Gm14496	UTSW	2	182000686	missense	probably damaging	1.00
R7565:Gm14496	UTSW	2	181991257	missense	possibly damaging	0.84
R7565:Gm14496	UTSW	2	182000837	missense	probably damaging	0.99
R7669:Gm14496	UTSW	2	181995918	missense	possibly damaging	0.95
R7828:Gm14496	UTSW	2	181991378	nonsense	probably null
R7870:Gm14496	UTSW	2	181996113	missense	probably benign	0.09
R8006:Gm14496	UTSW	2	181995876	missense	probably benign	0.03
R8379:Gm14496	UTSW	2	182000482	missense	probably damaging	0.99
R9174:Gm14496	UTSW	2	182001004	missense	possibly damaging	0.95
R9416:Gm14496	UTSW	2	181998854	missense	probably damaging	1.00
R9429:Gm14496	UTSW	2	181996141	missense	possibly damaging	0.60
R9463:Gm14496	UTSW	2	182000463	missense	probably benign	0.15
R9499:Gm14496	UTSW	2	181996386	missense	probably benign	0.00
R9581:Gm14496	UTSW	2	182000254	missense	probably benign	0.10
X0058:Gm14496	UTSW	2	181995986	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CATGATAGGTTGCCCCATGTCCATC -3'
(R):5'- AGTGAAATCTCGTTTGGGATCTGCC -3'

Sequencing Primer
(F):5'- GACAACCAGGGTATTCAGTTTCTC -3'
(R):5'- GGGATCTGCCCTTTTCTGAGAC -3'

Posted On

2014-04-24