Incidental Mutation 'R1610:Frg2f1'
ID176721
Institutional Source Beutler Lab
Gene Symbol Frg2f1
Ensembl Gene ENSMUSG00000087385
Gene NameFSHD region gene 2 family member 1
SynonymsAA415398
MMRRC Submission 039647-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R1610 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location119530308-119539529 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119531288 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 5 (T5S)
Ref Sequence ENSEMBL: ENSMUSP00000078560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079611]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079611
AA Change: T5S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078560
Gene: ENSMUSG00000087385
AA Change: T5S

DomainStartEndE-ValueType
low complexity region 62 72 N/A INTRINSIC
Pfam:FRG2 75 190 4.8e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137671
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149305
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178059
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik G T 6: 96,165,289 P258Q probably damaging Het
4930452B06Rik G T 14: 8,511,110 H435N probably benign Het
Acbd5 G A 2: 23,090,551 C312Y probably damaging Het
Adgrl1 T A 8: 83,932,373 M601K probably benign Het
Agbl4 G A 4: 111,657,168 E459K probably benign Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Casz1 C T 4: 148,929,087 A36V possibly damaging Het
Chpf A G 1: 75,476,648 V327A probably damaging Het
Cldn23 A G 8: 35,825,930 Y135H probably damaging Het
Cobll1 C T 2: 65,133,642 D211N probably damaging Het
Cramp1l A G 17: 24,983,951 V368A probably benign Het
Dnah6 T C 6: 73,144,963 T1374A probably benign Het
Dpyd A G 3: 119,065,006 H623R probably benign Het
Dyrk2 T C 10: 118,859,925 N476S probably benign Het
Endog A T 2: 30,173,887 I267F probably damaging Het
Ephb6 A T 6: 41,614,373 K155* probably null Het
Far2 T C 6: 148,157,458 V214A possibly damaging Het
Fat2 A G 11: 55,278,924 V3003A probably damaging Het
Gm14496 A T 2: 181,996,179 T349S probably benign Het
Golgb1 A G 16: 36,926,101 T2951A probably benign Het
Hc G T 2: 35,006,161 D1203E probably benign Het
Isg20 C A 7: 78,914,509 Q55K possibly damaging Het
Jph4 G T 14: 55,114,103 A152E probably damaging Het
Kcnq3 T C 15: 66,025,260 T264A probably damaging Het
Kcnq5 T G 1: 21,457,461 T463P probably damaging Het
Klra8 A G 6: 130,119,018 S204P probably damaging Het
Ldlrad1 A G 4: 107,214,875 D98G probably damaging Het
Lhfpl4 T C 6: 113,194,136 T30A possibly damaging Het
Lig1 T A 7: 13,285,340 L80Q probably damaging Het
Lmbrd2 A G 15: 9,186,612 Y558C probably benign Het
Lrrn3 G T 12: 41,452,993 L442I possibly damaging Het
Mc2r A G 18: 68,407,448 F258S probably damaging Het
Mmp16 A G 4: 18,011,582 T137A probably benign Het
Nfatc2ip A T 7: 126,387,407 S359T probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1193 A T 2: 88,678,574 K233* probably null Het
Olfr1229 T C 2: 89,282,821 H104R probably damaging Het
Olfr514 T A 7: 108,825,924 H25L probably benign Het
Olfr904 C T 9: 38,464,631 L197F probably damaging Het
Plagl1 C T 10: 13,128,962 probably benign Het
Plxnb2 A T 15: 89,158,493 S1531T probably damaging Het
Ptpn22 G A 3: 103,902,196 probably null Het
Rtn1 T A 12: 72,219,279 Q174L possibly damaging Het
Selenoo A G 15: 89,099,916 E645G probably benign Het
Serpina1a A C 12: 103,853,837 D383E possibly damaging Het
Slc6a18 T A 13: 73,668,225 Y345F probably benign Het
Smbd1 A G 16: 32,806,765 V51A possibly damaging Het
Tchh C T 3: 93,444,839 R529W unknown Het
Tmem206 A G 1: 191,345,065 D195G probably benign Het
Tonsl A T 15: 76,638,557 Y165N probably damaging Het
Trdmt1 G A 2: 13,516,059 T344I probably damaging Het
Ubash3b C A 9: 41,043,500 R116L probably damaging Het
Vmn2r94 A G 17: 18,243,733 V765A probably damaging Het
Zfp474 C T 18: 52,638,365 T30I probably benign Het
Other mutations in Frg2f1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Frg2f1 APN 4 119531110 missense possibly damaging 0.84
IGL02347:Frg2f1 APN 4 119530732 missense probably damaging 1.00
IGL02458:Frg2f1 APN 4 119530957 missense probably damaging 0.99
R1842:Frg2f1 UTSW 4 119531080 missense possibly damaging 0.59
R3872:Frg2f1 UTSW 4 119530958 missense possibly damaging 0.95
R5080:Frg2f1 UTSW 4 119531033 missense possibly damaging 0.95
R6870:Frg2f1 UTSW 4 119531132 missense probably benign 0.03
R7473:Frg2f1 UTSW 4 119530793 missense probably benign 0.16
R8996:Frg2f1 UTSW 4 119530888 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGTGTTTCCACCATCTGAGCTGATT -3'
(R):5'- ACCACACTGTGAGTACTAACTGTTCCT -3'

Sequencing Primer
(F):5'- ACCATCTGAGCTGATTCTTCAGTG -3'
(R):5'- gaatctctaaactgggaacacac -3'
Posted On2014-04-24