Mutagenetix > Incidental Mutation

Incidental Mutation 'R1610:Ephb6'

176725

Institutional Source

Beutler Lab

Gene Symbol

Ephb6

Ensembl Gene

ENSMUSG00000029869

Gene Name

Eph receptor B6

Synonyms

Cekl, Mep

MMRRC Submission

039647-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.501) question?

Stock #

R1610 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

41605482-41620509 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 41614373 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 155 (K155*)

Ref Sequence

ENSEMBL: ENSMUSP00000110380 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114732]

AlphaFold

O08644

Predicted Effect

probably null
Transcript: ENSMUST00000114732
AA Change: K155*

SMART Domains

Protein: ENSMUSP00000110380
Gene: ENSMUSG00000029869
AA Change: K155*

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
EPH_lbd	34	227	2.18e-100	SMART
low complexity region	242	255	N/A	INTRINSIC
Pfam:GCC2_GCC3	299	341	1.9e-9	PFAM
FN3	365	462	3.59e-3	SMART
FN3	481	562	3.73e-10	SMART
Pfam:EphA2_TM	589	660	3.4e-16	PFAM
Pfam:Pkinase	663	908	1.4e-29	PFAM
Pfam:Pkinase_Tyr	663	908	1.1e-67	PFAM
SAM	938	1005	1e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167082

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170624

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of transmembrane proteins that function as receptors for ephrin-B family proteins. Unlike other members of this family, the encoded protein does not contain a functional kinase domain. Activity of this protein can influence cell adhesion and migration. Expression of this gene is downregulated during tumor progression, suggesting that the protein may suppress tumor invasion and metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: T cell responses such as lymphokine secretion, proliferation, and the development of delayed-type skin hypersensitivity and experimental autoimmune encephalitis were compromised in homozygous null mutants. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	G	T	6: 96,165,289	P258Q	probably damaging	Het
4930452B06Rik	G	T	14: 8,511,110	H435N	probably benign	Het
Acbd5	G	A	2: 23,090,551	C312Y	probably damaging	Het
Adgrl1	T	A	8: 83,932,373	M601K	probably benign	Het
Agbl4	G	A	4: 111,657,168	E459K	probably benign	Het
Anxa2	TCCC	TCC	9: 69,489,754		probably null	Het
Casz1	C	T	4: 148,929,087	A36V	possibly damaging	Het
Chpf	A	G	1: 75,476,648	V327A	probably damaging	Het
Cldn23	A	G	8: 35,825,930	Y135H	probably damaging	Het
Cobll1	C	T	2: 65,133,642	D211N	probably damaging	Het
Cramp1l	A	G	17: 24,983,951	V368A	probably benign	Het
Dnah6	T	C	6: 73,144,963	T1374A	probably benign	Het
Dpyd	A	G	3: 119,065,006	H623R	probably benign	Het
Dyrk2	T	C	10: 118,859,925	N476S	probably benign	Het
Endog	A	T	2: 30,173,887	I267F	probably damaging	Het
Far2	T	C	6: 148,157,458	V214A	possibly damaging	Het
Fat2	A	G	11: 55,278,924	V3003A	probably damaging	Het
Frg2f1	T	A	4: 119,531,288	T5S	possibly damaging	Het
Gm14496	A	T	2: 181,996,179	T349S	probably benign	Het
Golgb1	A	G	16: 36,926,101	T2951A	probably benign	Het
Hc	G	T	2: 35,006,161	D1203E	probably benign	Het
Isg20	C	A	7: 78,914,509	Q55K	possibly damaging	Het
Jph4	G	T	14: 55,114,103	A152E	probably damaging	Het
Kcnq3	T	C	15: 66,025,260	T264A	probably damaging	Het
Kcnq5	T	G	1: 21,457,461	T463P	probably damaging	Het
Klra8	A	G	6: 130,119,018	S204P	probably damaging	Het
Ldlrad1	A	G	4: 107,214,875	D98G	probably damaging	Het
Lhfpl4	T	C	6: 113,194,136	T30A	possibly damaging	Het
Lig1	T	A	7: 13,285,340	L80Q	probably damaging	Het
Lmbrd2	A	G	15: 9,186,612	Y558C	probably benign	Het
Lrrn3	G	T	12: 41,452,993	L442I	possibly damaging	Het
Mc2r	A	G	18: 68,407,448	F258S	probably damaging	Het
Mmp16	A	G	4: 18,011,582	T137A	probably benign	Het
Nfatc2ip	A	T	7: 126,387,407	S359T	probably damaging	Het
Nup214	C	T	2: 32,034,466	S1669F	probably damaging	Het
Olfr1193	A	T	2: 88,678,574	K233*	probably null	Het
Olfr1229	T	C	2: 89,282,821	H104R	probably damaging	Het
Olfr514	T	A	7: 108,825,924	H25L	probably benign	Het
Olfr904	C	T	9: 38,464,631	L197F	probably damaging	Het
Plagl1	C	T	10: 13,128,962		probably benign	Het
Plxnb2	A	T	15: 89,158,493	S1531T	probably damaging	Het
Ptpn22	G	A	3: 103,902,196		probably null	Het
Rtn1	T	A	12: 72,219,279	Q174L	possibly damaging	Het
Selenoo	A	G	15: 89,099,916	E645G	probably benign	Het
Serpina1a	A	C	12: 103,853,837	D383E	possibly damaging	Het
Slc6a18	T	A	13: 73,668,225	Y345F	probably benign	Het
Smbd1	A	G	16: 32,806,765	V51A	possibly damaging	Het
Tchh	C	T	3: 93,444,839	R529W	unknown	Het
Tmem206	A	G	1: 191,345,065	D195G	probably benign	Het
Tonsl	A	T	15: 76,638,557	Y165N	probably damaging	Het
Trdmt1	G	A	2: 13,516,059	T344I	probably damaging	Het
Ubash3b	C	A	9: 41,043,500	R116L	probably damaging	Het
Vmn2r94	A	G	17: 18,243,733	V765A	probably damaging	Het
Zfp474	C	T	18: 52,638,365	T30I	probably benign	Het

Other mutations in Ephb6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01375:Ephb6	APN	6	41615911	unclassified	probably benign
IGL01691:Ephb6	APN	6	41614515	missense	probably benign	0.26
IGL02052:Ephb6	APN	6	41613322	missense	probably benign
IGL02079:Ephb6	APN	6	41616014	missense	possibly damaging	0.57
IGL03089:Ephb6	APN	6	41614174	missense	probably damaging	1.00
P4748:Ephb6	UTSW	6	41617285	missense	probably damaging	0.96
R0022:Ephb6	UTSW	6	41614569	missense	probably damaging	0.98
R0022:Ephb6	UTSW	6	41614569	missense	probably damaging	0.98
R0106:Ephb6	UTSW	6	41619594	unclassified	probably benign
R0106:Ephb6	UTSW	6	41619594	unclassified	probably benign
R0973:Ephb6	UTSW	6	41614104	missense	probably damaging	0.98
R0973:Ephb6	UTSW	6	41614104	missense	probably damaging	0.98
R0974:Ephb6	UTSW	6	41614104	missense	probably damaging	0.98
R1465:Ephb6	UTSW	6	41616106	missense	probably damaging	1.00
R1465:Ephb6	UTSW	6	41616106	missense	probably damaging	1.00
R1658:Ephb6	UTSW	6	41614245	missense	probably damaging	1.00
R1687:Ephb6	UTSW	6	41617366	missense	probably benign	0.08
R1733:Ephb6	UTSW	6	41619720	missense	probably benign	0.10
R2191:Ephb6	UTSW	6	41616085	missense	possibly damaging	0.82
R2439:Ephb6	UTSW	6	41618735	missense	probably benign	0.31
R2915:Ephb6	UTSW	6	41614238	missense	probably damaging	1.00
R3020:Ephb6	UTSW	6	41614521	missense	probably damaging	1.00
R3499:Ephb6	UTSW	6	41616159	nonsense	probably null
R4606:Ephb6	UTSW	6	41616574	missense	probably benign	0.15
R4663:Ephb6	UTSW	6	41617865	missense	probably damaging	1.00
R4668:Ephb6	UTSW	6	41614602	missense	possibly damaging	0.91
R4762:Ephb6	UTSW	6	41618160	missense	probably damaging	0.99
R4767:Ephb6	UTSW	6	41614185	missense	possibly damaging	0.81
R4780:Ephb6	UTSW	6	41616139	missense	probably damaging	1.00
R4846:Ephb6	UTSW	6	41616809	missense	probably benign
R4851:Ephb6	UTSW	6	41618145	missense	probably benign	0.00
R5016:Ephb6	UTSW	6	41618107	missense	probably benign	0.01
R5122:Ephb6	UTSW	6	41613404	missense	probably benign	0.00
R5313:Ephb6	UTSW	6	41616793	missense	possibly damaging	0.68
R5615:Ephb6	UTSW	6	41619291	missense	probably benign
R5623:Ephb6	UTSW	6	41616481	missense	probably benign	0.20
R5686:Ephb6	UTSW	6	41619704	missense	possibly damaging	0.57
R5840:Ephb6	UTSW	6	41615573	missense	possibly damaging	0.94
R6147:Ephb6	UTSW	6	41616781	missense	probably damaging	1.00
R6645:Ephb6	UTSW	6	41617272	missense	probably benign	0.01
R6730:Ephb6	UTSW	6	41617374	nonsense	probably null
R7412:Ephb6	UTSW	6	41620239	missense	probably damaging	1.00
R7442:Ephb6	UTSW	6	41618047	splice site	probably null
R7759:Ephb6	UTSW	6	41614605	missense	probably benign	0.00
R7857:Ephb6	UTSW	6	41613397	missense	probably benign
R8425:Ephb6	UTSW	6	41618646	missense	probably damaging	0.98
R8697:Ephb6	UTSW	6	41614223	missense	probably damaging	0.99
R8898:Ephb6	UTSW	6	41613359	missense	probably benign
R8959:Ephb6	UTSW	6	41613359	missense	probably benign
R8961:Ephb6	UTSW	6	41613359	missense	probably benign
R8980:Ephb6	UTSW	6	41613359	missense	probably benign
R8989:Ephb6	UTSW	6	41613359	missense	probably benign
R8992:Ephb6	UTSW	6	41613359	missense	probably benign
R9065:Ephb6	UTSW	6	41613359	missense	probably benign
R9413:Ephb6	UTSW	6	41614575	missense
R9512:Ephb6	UTSW	6	41616096	missense	possibly damaging	0.70
R9617:Ephb6	UTSW	6	41619324	missense	probably damaging	1.00
R9619:Ephb6	UTSW	6	41617315	missense	possibly damaging	0.72
R9705:Ephb6	UTSW	6	41619781	missense	probably benign	0.05
R9764:Ephb6	UTSW	6	41615977	missense	probably benign	0.01
X0027:Ephb6	UTSW	6	41620080	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- TGAGTGTTCTAGATGACCAGCGCC -3'
(R):5'- CACATAGAAGCCACGCTGAGTGAG -3'

Sequencing Primer
(F):5'- TGCAGACACACTTTGTGGAAC -3'
(R):5'- CCACGCTGAGTGAGAGGAC -3'

Posted On

2014-04-24