Incidental Mutation 'R1610:Far2'
ID176731
Institutional Source Beutler Lab
Gene Symbol Far2
Ensembl Gene ENSMUSG00000030303
Gene Namefatty acyl CoA reductase 2
SynonymsMlstd1
MMRRC Submission 039647-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1610 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location148047259-148182758 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 148157458 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 214 (V214A)
Ref Sequence ENSEMBL: ENSMUSP00000107234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032443] [ENSMUST00000111607]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032443
AA Change: V214A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000032443
Gene: ENSMUSG00000030303
AA Change: V214A

DomainStartEndE-ValueType
Pfam:Polysacc_synt_2 13 160 5.3e-8 PFAM
Pfam:Epimerase 13 242 7.5e-9 PFAM
Pfam:3Beta_HSD 14 167 3.4e-7 PFAM
Pfam:NAD_binding_4 15 285 3.3e-76 PFAM
Pfam:Sterile 356 448 4.3e-35 PFAM
transmembrane domain 465 484 N/A INTRINSIC
transmembrane domain 491 510 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111607
AA Change: V214A

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107234
Gene: ENSMUSG00000030303
AA Change: V214A

DomainStartEndE-ValueType
Pfam:Polysacc_synt_2 13 159 2.9e-8 PFAM
Pfam:Epimerase 13 241 3.2e-10 PFAM
Pfam:3Beta_HSD 14 167 4.2e-7 PFAM
Pfam:NAD_binding_4 15 285 3.2e-73 PFAM
Pfam:Sterile 355 448 1.2e-29 PFAM
transmembrane domain 466 483 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the short chain dehydrogenase/reductase superfamily. It encodes a reductase enzyme involved in the first step of wax biosynthesis wherein fatty acids are converted to fatty alcohols. The encoded peroxisomal protein utilizes saturated fatty acids of 16 or 18 carbons as preferred substrates. Alternatively spliced transcript variants have been observed for this gene. Related pseudogenes have been identified on chromosomes 2, 14 and 22. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik G T 6: 96,165,289 P258Q probably damaging Het
4930452B06Rik G T 14: 8,511,110 H435N probably benign Het
Acbd5 G A 2: 23,090,551 C312Y probably damaging Het
Adgrl1 T A 8: 83,932,373 M601K probably benign Het
Agbl4 G A 4: 111,657,168 E459K probably benign Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Casz1 C T 4: 148,929,087 A36V possibly damaging Het
Chpf A G 1: 75,476,648 V327A probably damaging Het
Cldn23 A G 8: 35,825,930 Y135H probably damaging Het
Cobll1 C T 2: 65,133,642 D211N probably damaging Het
Cramp1l A G 17: 24,983,951 V368A probably benign Het
Dnah6 T C 6: 73,144,963 T1374A probably benign Het
Dpyd A G 3: 119,065,006 H623R probably benign Het
Dyrk2 T C 10: 118,859,925 N476S probably benign Het
Endog A T 2: 30,173,887 I267F probably damaging Het
Ephb6 A T 6: 41,614,373 K155* probably null Het
Fat2 A G 11: 55,278,924 V3003A probably damaging Het
Frg2f1 T A 4: 119,531,288 T5S possibly damaging Het
Gm14496 A T 2: 181,996,179 T349S probably benign Het
Golgb1 A G 16: 36,926,101 T2951A probably benign Het
Hc G T 2: 35,006,161 D1203E probably benign Het
Isg20 C A 7: 78,914,509 Q55K possibly damaging Het
Jph4 G T 14: 55,114,103 A152E probably damaging Het
Kcnq3 T C 15: 66,025,260 T264A probably damaging Het
Kcnq5 T G 1: 21,457,461 T463P probably damaging Het
Klra8 A G 6: 130,119,018 S204P probably damaging Het
Ldlrad1 A G 4: 107,214,875 D98G probably damaging Het
Lhfpl4 T C 6: 113,194,136 T30A possibly damaging Het
Lig1 T A 7: 13,285,340 L80Q probably damaging Het
Lmbrd2 A G 15: 9,186,612 Y558C probably benign Het
Lrrn3 G T 12: 41,452,993 L442I possibly damaging Het
Mc2r A G 18: 68,407,448 F258S probably damaging Het
Mmp16 A G 4: 18,011,582 T137A probably benign Het
Nfatc2ip A T 7: 126,387,407 S359T probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1193 A T 2: 88,678,574 K233* probably null Het
Olfr1229 T C 2: 89,282,821 H104R probably damaging Het
Olfr514 T A 7: 108,825,924 H25L probably benign Het
Olfr904 C T 9: 38,464,631 L197F probably damaging Het
Plagl1 C T 10: 13,128,962 probably benign Het
Plxnb2 A T 15: 89,158,493 S1531T probably damaging Het
Ptpn22 G A 3: 103,902,196 probably null Het
Rtn1 T A 12: 72,219,279 Q174L possibly damaging Het
Selenoo A G 15: 89,099,916 E645G probably benign Het
Serpina1a A C 12: 103,853,837 D383E possibly damaging Het
Slc6a18 T A 13: 73,668,225 Y345F probably benign Het
Smbd1 A G 16: 32,806,765 V51A possibly damaging Het
Tchh C T 3: 93,444,839 R529W unknown Het
Tmem206 A G 1: 191,345,065 D195G probably benign Het
Tonsl A T 15: 76,638,557 Y165N probably damaging Het
Trdmt1 G A 2: 13,516,059 T344I probably damaging Het
Ubash3b C A 9: 41,043,500 R116L probably damaging Het
Vmn2r94 A G 17: 18,243,733 V765A probably damaging Het
Zfp474 C T 18: 52,638,365 T30I probably benign Het
Other mutations in Far2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Far2 APN 6 148150598 missense possibly damaging 0.89
IGL01650:Far2 APN 6 148173487 missense possibly damaging 0.92
IGL01899:Far2 APN 6 148146029 missense probably benign 0.19
IGL02524:Far2 APN 6 148150658 missense probably damaging 1.00
IGL02756:Far2 APN 6 148157391 missense probably damaging 1.00
Galway UTSW 6 148157482 missense probably damaging 0.99
PIT4531001:Far2 UTSW 6 148175131 missense possibly damaging 0.95
R0319:Far2 UTSW 6 148157470 missense probably damaging 0.96
R0654:Far2 UTSW 6 148175141 missense possibly damaging 0.64
R1321:Far2 UTSW 6 148173536 splice site probably benign
R2039:Far2 UTSW 6 148165577 missense probably benign
R2471:Far2 UTSW 6 148138694 missense probably damaging 1.00
R3874:Far2 UTSW 6 148150591 missense probably benign 0.00
R3875:Far2 UTSW 6 148150591 missense probably benign 0.00
R3974:Far2 UTSW 6 148150754 missense probably damaging 0.96
R4490:Far2 UTSW 6 148173409 missense possibly damaging 0.88
R4491:Far2 UTSW 6 148173409 missense possibly damaging 0.88
R5034:Far2 UTSW 6 148173441 missense probably benign 0.43
R5421:Far2 UTSW 6 148146192 splice site probably null
R5673:Far2 UTSW 6 148146104 missense possibly damaging 0.86
R6092:Far2 UTSW 6 148175083 missense probably benign 0.00
R6294:Far2 UTSW 6 148157482 missense probably damaging 0.99
R6325:Far2 UTSW 6 148157497 missense probably benign 0.30
R6783:Far2 UTSW 6 148150775 splice site probably null
R7380:Far2 UTSW 6 148180995 missense unknown
R7403:Far2 UTSW 6 148158977 missense possibly damaging 0.93
R7484:Far2 UTSW 6 148173913 missense probably damaging 1.00
R8276:Far2 UTSW 6 148173901 missense probably benign 0.00
X0053:Far2 UTSW 6 148165640 missense probably benign 0.00
Z1088:Far2 UTSW 6 148138658 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTTGTCCTTGTGACCCTGAGATG -3'
(R):5'- ACCGCAATAATGAGTCCGCTGG -3'

Sequencing Primer
(F):5'- GCCTTTCAGAATTTCAAGCCAG -3'
(R):5'- ggaagaggaagaggagaagagg -3'
Posted On2014-04-24