Mutagenetix > Incidental Mutation

Incidental Mutation 'R1610:Lig1'

176732

Institutional Source

Beutler Lab

Gene Symbol

Lig1

Ensembl Gene

ENSMUSG00000056394

Gene Name

ligase I, DNA, ATP-dependent

Synonyms

LigI, mLigI

MMRRC Submission

039647-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1610 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

13277283-13311433 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 13285340 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 80 (L80Q)

Ref Sequence

ENSEMBL: ENSMUSP00000121102 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098814] [ENSMUST00000123025] [ENSMUST00000146998] [ENSMUST00000165964] [ENSMUST00000177588] [ENSMUST00000185145]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000098814
AA Change: L80Q

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000096411
Gene: ENSMUSG00000056394
AA Change: L80Q

Domain	Start	End	E-Value	Type
low complexity region	99	111	N/A	INTRINSIC
coiled coil region	149	173	N/A	INTRINSIC
Pfam:DNA_ligase_A_N	301	479	8.6e-50	PFAM
Pfam:DNA_ligase_A_M	556	760	3.4e-67	PFAM
Pfam:DNA_ligase_A_C	785	896	9.4e-28	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000123025
AA Change: L80Q

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000114872
Gene: ENSMUSG00000056394
AA Change: L80Q

Domain	Start	End	E-Value	Type
low complexity region	96	111	N/A	INTRINSIC
low complexity region	159	177	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123846

SMART Domains

Protein: ENSMUSP00000119788
Gene: ENSMUSG00000056394

Domain	Start	End	E-Value	Type
low complexity region	99	111	N/A	INTRINSIC
coiled coil region	149	173	N/A	INTRINSIC
Pfam:DNA_ligase_A_N	301	479	4e-47	PFAM
Pfam:DNA_ligase_A_M	556	687	1e-38	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000146998
AA Change: L80Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000121102
Gene: ENSMUSG00000056394
AA Change: L80Q

Domain	Start	End	E-Value	Type
low complexity region	99	111	N/A	INTRINSIC
low complexity region	160	178	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147735

SMART Domains

Protein: ENSMUSP00000115286
Gene: ENSMUSG00000056394

Domain	Start	End	E-Value	Type
low complexity region	99	111	N/A	INTRINSIC
coiled coil region	149	173	N/A	INTRINSIC
Pfam:DNA_ligase_A_N	301	479	4e-47	PFAM
Pfam:DNA_ligase_A_M	556	687	1e-38	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148471

SMART Domains

Protein: ENSMUSP00000114153
Gene: ENSMUSG00000056394

Domain	Start	End	E-Value	Type
low complexity region	99	111	N/A	INTRINSIC
coiled coil region	149	173	N/A	INTRINSIC
Pfam:DNA_ligase_A_N	301	479	4e-47	PFAM
Pfam:DNA_ligase_A_M	556	687	1e-38	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156525

SMART Domains

Protein: ENSMUSP00000118055
Gene: ENSMUSG00000056394

Domain	Start	End	E-Value	Type
low complexity region	99	111	N/A	INTRINSIC
coiled coil region	149	173	N/A	INTRINSIC
Pfam:DNA_ligase_A_N	301	479	4e-47	PFAM
Pfam:DNA_ligase_A_M	556	687	1e-38	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000165964
AA Change: L80Q

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000126525
Gene: ENSMUSG00000056394
AA Change: L80Q

Domain	Start	End	E-Value	Type
low complexity region	99	111	N/A	INTRINSIC
coiled coil region	149	173	N/A	INTRINSIC
Pfam:DNA_ligase_A_N	302	478	1.7e-40	PFAM
Pfam:DNA_ligase_A_M	556	760	1.1e-69	PFAM
Pfam:DNA_ligase_A_C	785	896	1.6e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000177588
AA Change: L80Q

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000136972
Gene: ENSMUSG00000056394
AA Change: L80Q

Domain	Start	End	E-Value	Type
low complexity region	99	111	N/A	INTRINSIC
coiled coil region	149	173	N/A	INTRINSIC
Pfam:DNA_ligase_A_N	301	479	8.6e-50	PFAM
Pfam:DNA_ligase_A_M	556	760	3.4e-67	PFAM
Pfam:DNA_ligase_A_C	785	896	9.4e-28	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000185145
AA Change: L80Q

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000138907
Gene: ENSMUSG00000056394
AA Change: L80Q

Domain	Start	End	E-Value	Type
low complexity region	99	111	N/A	INTRINSIC
coiled coil region	149	173	N/A	INTRINSIC
PDB:1X9N\|A	247	313	3e-24	PDB

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ATP-dependent DNA ligase protein family. The encoded protein functions in DNA replication, recombination, and the base excision repair process. Mutations in this gene that lead to DNA ligase I deficiency result in immunodeficiency and increased sensitivity to DNA-damaging agents. Disruption of this gene may also be associated with a variety of cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired fetal hematopoiesis, develop anemia, and die by E16.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	G	T	6: 96,165,289	P258Q	probably damaging	Het
4930452B06Rik	G	T	14: 8,511,110	H435N	probably benign	Het
Acbd5	G	A	2: 23,090,551	C312Y	probably damaging	Het
Adgrl1	T	A	8: 83,932,373	M601K	probably benign	Het
Agbl4	G	A	4: 111,657,168	E459K	probably benign	Het
Anxa2	TCCC	TCC	9: 69,489,754		probably null	Het
Casz1	C	T	4: 148,929,087	A36V	possibly damaging	Het
Chpf	A	G	1: 75,476,648	V327A	probably damaging	Het
Cldn23	A	G	8: 35,825,930	Y135H	probably damaging	Het
Cobll1	C	T	2: 65,133,642	D211N	probably damaging	Het
Cramp1l	A	G	17: 24,983,951	V368A	probably benign	Het
Dnah6	T	C	6: 73,144,963	T1374A	probably benign	Het
Dpyd	A	G	3: 119,065,006	H623R	probably benign	Het
Dyrk2	T	C	10: 118,859,925	N476S	probably benign	Het
Endog	A	T	2: 30,173,887	I267F	probably damaging	Het
Ephb6	A	T	6: 41,614,373	K155*	probably null	Het
Far2	T	C	6: 148,157,458	V214A	possibly damaging	Het
Fat2	A	G	11: 55,278,924	V3003A	probably damaging	Het
Frg2f1	T	A	4: 119,531,288	T5S	possibly damaging	Het
Gm14496	A	T	2: 181,996,179	T349S	probably benign	Het
Golgb1	A	G	16: 36,926,101	T2951A	probably benign	Het
Hc	G	T	2: 35,006,161	D1203E	probably benign	Het
Isg20	C	A	7: 78,914,509	Q55K	possibly damaging	Het
Jph4	G	T	14: 55,114,103	A152E	probably damaging	Het
Kcnq3	T	C	15: 66,025,260	T264A	probably damaging	Het
Kcnq5	T	G	1: 21,457,461	T463P	probably damaging	Het
Klra8	A	G	6: 130,119,018	S204P	probably damaging	Het
Ldlrad1	A	G	4: 107,214,875	D98G	probably damaging	Het
Lhfpl4	T	C	6: 113,194,136	T30A	possibly damaging	Het
Lmbrd2	A	G	15: 9,186,612	Y558C	probably benign	Het
Lrrn3	G	T	12: 41,452,993	L442I	possibly damaging	Het
Mc2r	A	G	18: 68,407,448	F258S	probably damaging	Het
Mmp16	A	G	4: 18,011,582	T137A	probably benign	Het
Nfatc2ip	A	T	7: 126,387,407	S359T	probably damaging	Het
Nup214	C	T	2: 32,034,466	S1669F	probably damaging	Het
Olfr1193	A	T	2: 88,678,574	K233*	probably null	Het
Olfr1229	T	C	2: 89,282,821	H104R	probably damaging	Het
Olfr514	T	A	7: 108,825,924	H25L	probably benign	Het
Olfr904	C	T	9: 38,464,631	L197F	probably damaging	Het
Plagl1	C	T	10: 13,128,962		probably benign	Het
Plxnb2	A	T	15: 89,158,493	S1531T	probably damaging	Het
Ptpn22	G	A	3: 103,902,196		probably null	Het
Rtn1	T	A	12: 72,219,279	Q174L	possibly damaging	Het
Selenoo	A	G	15: 89,099,916	E645G	probably benign	Het
Serpina1a	A	C	12: 103,853,837	D383E	possibly damaging	Het
Slc6a18	T	A	13: 73,668,225	Y345F	probably benign	Het
Smbd1	A	G	16: 32,806,765	V51A	possibly damaging	Het
Tchh	C	T	3: 93,444,839	R529W	unknown	Het
Tmem206	A	G	1: 191,345,065	D195G	probably benign	Het
Tonsl	A	T	15: 76,638,557	Y165N	probably damaging	Het
Trdmt1	G	A	2: 13,516,059	T344I	probably damaging	Het
Ubash3b	C	A	9: 41,043,500	R116L	probably damaging	Het
Vmn2r94	A	G	17: 18,243,733	V765A	probably damaging	Het
Zfp474	C	T	18: 52,638,365	T30I	probably benign	Het

Other mutations in Lig1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Lig1	APN	7	13301452	nonsense	probably null
IGL00499:Lig1	APN	7	13298830	critical splice donor site	probably null
IGL01465:Lig1	APN	7	13296391	missense	probably benign	0.19
IGL01804:Lig1	APN	7	13309206	missense	probably benign	0.43
IGL02068:Lig1	APN	7	13292451	splice site	probably benign
IGL02955:Lig1	APN	7	13296347	missense	probably damaging	0.99
IGL03188:Lig1	APN	7	13311107	splice site	probably benign
IGL03327:Lig1	APN	7	13303855	missense	probably damaging	1.00
IGL03411:Lig1	APN	7	13296768	missense	probably damaging	1.00
PIT4142001:Lig1	UTSW	7	13305924	frame shift	probably null
R0085:Lig1	UTSW	7	13307570	missense	possibly damaging	0.66
R0348:Lig1	UTSW	7	13309197	missense	probably damaging	1.00
R0362:Lig1	UTSW	7	13296804	unclassified	probably benign
R0787:Lig1	UTSW	7	13299069	missense	probably benign	0.41
R1170:Lig1	UTSW	7	13292153	missense	probably benign	0.00
R1371:Lig1	UTSW	7	13288685	missense	probably damaging	1.00
R1809:Lig1	UTSW	7	13300355	splice site	probably benign
R1986:Lig1	UTSW	7	13309142	nonsense	probably null
R2106:Lig1	UTSW	7	13305938	missense	probably damaging	1.00
R2343:Lig1	UTSW	7	13292195	splice site	probably null
R2380:Lig1	UTSW	7	13303796	splice site	probably benign
R3545:Lig1	UTSW	7	13292163	missense	possibly damaging	0.82
R4669:Lig1	UTSW	7	13311028	missense	probably damaging	1.00
R4928:Lig1	UTSW	7	13298738	missense	probably damaging	1.00
R5167:Lig1	UTSW	7	13311058	missense	probably damaging	0.97
R5249:Lig1	UTSW	7	13308507	missense	possibly damaging	0.60
R5351:Lig1	UTSW	7	13300949	missense	probably damaging	1.00
R5373:Lig1	UTSW	7	13305923	frame shift	probably null
R5607:Lig1	UTSW	7	13306008	missense	probably damaging	0.97
R5608:Lig1	UTSW	7	13306008	missense	probably damaging	0.97
R5620:Lig1	UTSW	7	13286606	missense	possibly damaging	0.66
R5799:Lig1	UTSW	7	13296258	missense	possibly damaging	0.67
R6057:Lig1	UTSW	7	13288672	missense	probably damaging	0.99
R6897:Lig1	UTSW	7	13305914	missense	probably damaging	1.00
R7202:Lig1	UTSW	7	13291249	missense	probably benign	0.00
R7454:Lig1	UTSW	7	13288721	missense	probably damaging	0.99
R7548:Lig1	UTSW	7	13301418	missense	possibly damaging	0.79
R7596:Lig1	UTSW	7	13305998	missense	probably damaging	1.00
R7597:Lig1	UTSW	7	13296344	missense	probably benign
R7688:Lig1	UTSW	7	13289463	missense	probably benign
R7733:Lig1	UTSW	7	13296231	missense	possibly damaging	0.87
R8104:Lig1	UTSW	7	13286565	missense	possibly damaging	0.46
R8887:Lig1	UTSW	7	13296787	missense	probably damaging	1.00
R9025:Lig1	UTSW	7	13303820	missense	probably damaging	1.00
R9321:Lig1	UTSW	7	13301009	missense	probably damaging	1.00
R9555:Lig1	UTSW	7	13291474	missense	probably benign
X0020:Lig1	UTSW	7	13296774	missense	possibly damaging	0.48

Predicted Primers

PCR Primer
(F):5'- TGCTCACTGCTCACTGAAATGGAAG -3'
(R):5'- TGCCAATCTCCTGAACAATGTCCC -3'

Sequencing Primer
(F):5'- CTGCTCACTGAAATGGAAGAGAAG -3'
(R):5'- gctgcacaagcctagagac -3'

Posted On

2014-04-24