Incidental Mutation 'R1610:Olfr514'
ID176735
Institutional Source Beutler Lab
Gene Symbol Olfr514
Ensembl Gene ENSMUSG00000066241
Gene Nameolfactory receptor 514
SynonymsMOR268-1, GA_x6K02T2PBJ9-11156311-11155379
MMRRC Submission 039647-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R1610 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108825065-108825997 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108825924 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 25 (H25L)
Ref Sequence ENSEMBL: ENSMUSP00000081807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084754]
Predicted Effect probably benign
Transcript: ENSMUST00000084754
AA Change: H25L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081807
Gene: ENSMUSG00000066241
AA Change: H25L

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 3.9e-57 PFAM
Pfam:7tm_1 40 289 5e-21 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik G T 6: 96,165,289 P258Q probably damaging Het
4930452B06Rik G T 14: 8,511,110 H435N probably benign Het
Acbd5 G A 2: 23,090,551 C312Y probably damaging Het
Adgrl1 T A 8: 83,932,373 M601K probably benign Het
Agbl4 G A 4: 111,657,168 E459K probably benign Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Casz1 C T 4: 148,929,087 A36V possibly damaging Het
Chpf A G 1: 75,476,648 V327A probably damaging Het
Cldn23 A G 8: 35,825,930 Y135H probably damaging Het
Cobll1 C T 2: 65,133,642 D211N probably damaging Het
Cramp1l A G 17: 24,983,951 V368A probably benign Het
Dnah6 T C 6: 73,144,963 T1374A probably benign Het
Dpyd A G 3: 119,065,006 H623R probably benign Het
Dyrk2 T C 10: 118,859,925 N476S probably benign Het
Endog A T 2: 30,173,887 I267F probably damaging Het
Ephb6 A T 6: 41,614,373 K155* probably null Het
Far2 T C 6: 148,157,458 V214A possibly damaging Het
Fat2 A G 11: 55,278,924 V3003A probably damaging Het
Frg2f1 T A 4: 119,531,288 T5S possibly damaging Het
Gm14496 A T 2: 181,996,179 T349S probably benign Het
Golgb1 A G 16: 36,926,101 T2951A probably benign Het
Hc G T 2: 35,006,161 D1203E probably benign Het
Isg20 C A 7: 78,914,509 Q55K possibly damaging Het
Jph4 G T 14: 55,114,103 A152E probably damaging Het
Kcnq3 T C 15: 66,025,260 T264A probably damaging Het
Kcnq5 T G 1: 21,457,461 T463P probably damaging Het
Klra8 A G 6: 130,119,018 S204P probably damaging Het
Ldlrad1 A G 4: 107,214,875 D98G probably damaging Het
Lhfpl4 T C 6: 113,194,136 T30A possibly damaging Het
Lig1 T A 7: 13,285,340 L80Q probably damaging Het
Lmbrd2 A G 15: 9,186,612 Y558C probably benign Het
Lrrn3 G T 12: 41,452,993 L442I possibly damaging Het
Mc2r A G 18: 68,407,448 F258S probably damaging Het
Mmp16 A G 4: 18,011,582 T137A probably benign Het
Nfatc2ip A T 7: 126,387,407 S359T probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1193 A T 2: 88,678,574 K233* probably null Het
Olfr1229 T C 2: 89,282,821 H104R probably damaging Het
Olfr904 C T 9: 38,464,631 L197F probably damaging Het
Plagl1 C T 10: 13,128,962 probably benign Het
Plxnb2 A T 15: 89,158,493 S1531T probably damaging Het
Ptpn22 G A 3: 103,902,196 probably null Het
Rtn1 T A 12: 72,219,279 Q174L possibly damaging Het
Selenoo A G 15: 89,099,916 E645G probably benign Het
Serpina1a A C 12: 103,853,837 D383E possibly damaging Het
Slc6a18 T A 13: 73,668,225 Y345F probably benign Het
Smbd1 A G 16: 32,806,765 V51A possibly damaging Het
Tchh C T 3: 93,444,839 R529W unknown Het
Tmem206 A G 1: 191,345,065 D195G probably benign Het
Tonsl A T 15: 76,638,557 Y165N probably damaging Het
Trdmt1 G A 2: 13,516,059 T344I probably damaging Het
Ubash3b C A 9: 41,043,500 R116L probably damaging Het
Vmn2r94 A G 17: 18,243,733 V765A probably damaging Het
Zfp474 C T 18: 52,638,365 T30I probably benign Het
Other mutations in Olfr514
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Olfr514 APN 7 108825073 missense probably benign 0.00
IGL01469:Olfr514 APN 7 108825327 missense probably benign 0.29
IGL02079:Olfr514 APN 7 108825936 missense probably damaging 0.99
IGL02330:Olfr514 APN 7 108825999 unclassified probably benign
IGL02662:Olfr514 APN 7 108825745 missense probably benign 0.16
IGL02713:Olfr514 APN 7 108825594 missense probably damaging 1.00
R1158:Olfr514 UTSW 7 108825178 missense probably damaging 1.00
R1638:Olfr514 UTSW 7 108825235 missense probably benign 0.03
R4242:Olfr514 UTSW 7 108825459 missense probably benign
R4630:Olfr514 UTSW 7 108825595 missense probably damaging 1.00
R5042:Olfr514 UTSW 7 108825471 missense possibly damaging 0.72
R5967:Olfr514 UTSW 7 108825714 missense probably benign 0.12
R7180:Olfr514 UTSW 7 108825979 missense probably damaging 0.98
Z1088:Olfr514 UTSW 7 108825896 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGTCAGGACCACCAGCATCTCAG -3'
(R):5'- TGCAAGTGGTTAGGCATCCTTCAAG -3'

Sequencing Primer
(F):5'- CCAGCATCTCAGGCATAACAG -3'
(R):5'- GCATCCTTCAAGTTGCTAATTGTG -3'
Posted On2014-04-24