Mutagenetix > Incidental Mutation

Incidental Mutation 'R1610:Adgrl1'

176738

Institutional Source

Beutler Lab

Gene Symbol

Adgrl1

Ensembl Gene

ENSMUSG00000013033

Gene Name

adhesion G protein-coupled receptor L1

Synonyms

lectomedin-2, Lec2, Lphn1, 2900070I05Rik

MMRRC Submission

039647-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1610 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83900105-83941954 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 83932373 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 601 (M601K)

Ref Sequence

ENSEMBL: ENSMUSP00000118452 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045393] [ENSMUST00000098595] [ENSMUST00000124355] [ENSMUST00000131717] [ENSMUST00000132500] [ENSMUST00000141158] [ENSMUST00000152978]

AlphaFold

Q80TR1

Predicted Effect

probably benign
Transcript: ENSMUST00000045393
AA Change: M606K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000048422
Gene: ENSMUSG00000013033
AA Change: M606K

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:Gal_Lectin	48	128	6.6e-23	PFAM
OLF	142	398	8.5e-138	SMART
low complexity region	405	441	N/A	INTRINSIC
low complexity region	455	470	N/A	INTRINSIC
HormR	476	541	1.4e-23	SMART
low complexity region	579	591	N/A	INTRINSIC
low complexity region	747	758	N/A	INTRINSIC
GPS	797	849	3.5e-27	SMART
Pfam:7tm_2	856	1092	5.3e-66	PFAM
Pfam:Latrophilin	1112	1470	1.7e-177	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000098595

SMART Domains

Protein: ENSMUSP00000096195
Gene: ENSMUSG00000074219

Domain	Start	End	E-Value	Type
low complexity region	60	72	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124355

SMART Domains

Protein: ENSMUSP00000116064
Gene: ENSMUSG00000013033

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:Gal_Lectin	48	128	1.1e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131717
AA Change: M430K

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000118579
Gene: ENSMUSG00000013033
AA Change: M430K

Domain	Start	End	E-Value	Type
OLF	1	222	4.51e-103	SMART
low complexity region	229	265	N/A	INTRINSIC
low complexity region	279	294	N/A	INTRINSIC
HormR	300	365	2.26e-21	SMART
low complexity region	403	415	N/A	INTRINSIC
low complexity region	571	582	N/A	INTRINSIC
GPS	621	673	5.64e-25	SMART
Pfam:7tm_2	680	916	7.9e-68	PFAM
Pfam:Latrophilin	936	1295	2.7e-181	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000132500
AA Change: M601K

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000119100
Gene: ENSMUSG00000013033
AA Change: M601K

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:Gal_Lectin	48	128	1.6e-25	PFAM
OLF	137	393	1.39e-135	SMART
low complexity region	400	436	N/A	INTRINSIC
low complexity region	450	465	N/A	INTRINSIC
HormR	471	536	2.26e-21	SMART
low complexity region	574	586	N/A	INTRINSIC
low complexity region	742	753	N/A	INTRINSIC
GPS	792	844	5.64e-25	SMART
Pfam:7tm_2	851	1087	3.4e-68	PFAM
Pfam:Latrophilin	1146	1511	6.4e-193	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139575

Predicted Effect

probably benign
Transcript: ENSMUST00000141158
AA Change: M601K

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000118452
Gene: ENSMUSG00000013033
AA Change: M601K

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:Gal_Lectin	48	128	3.4e-25	PFAM
OLF	137	393	1.39e-135	SMART
low complexity region	400	436	N/A	INTRINSIC
low complexity region	450	465	N/A	INTRINSIC
HormR	471	536	2.26e-21	SMART
low complexity region	574	586	N/A	INTRINSIC
low complexity region	742	753	N/A	INTRINSIC
GPS	792	844	5.64e-25	SMART
Pfam:7tm_2	851	1087	4.5e-68	PFAM
Pfam:Latrophilin	1107	1466	1.1e-180	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141661

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150674

Predicted Effect

probably benign
Transcript: ENSMUST00000152978
AA Change: M606K

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000115295
Gene: ENSMUSG00000013033
AA Change: M606K

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:Gal_Lectin	48	128	2.1e-25	PFAM
OLF	142	398	1.39e-135	SMART
low complexity region	405	441	N/A	INTRINSIC
low complexity region	455	470	N/A	INTRINSIC
HormR	476	541	2.26e-21	SMART
Pfam:GAIN	544	773	4.1e-59	PFAM
GPS	797	849	5.64e-25	SMART
Pfam:7tm_2	856	1092	2.3e-69	PFAM
Pfam:Latrophilin	1112	1516	7.3e-136	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200106

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199528

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors (GPCR). Latrophilins may function in both cell adhesion and signal transduction. In experiments with non-human species, endogenous proteolytic cleavage within a cysteine-rich GPS (G-protein-coupled-receptor proteolysis site) domain resulted in two subunits (a large extracellular N-terminal cell adhesion subunit and a subunit with substantial similarity to the secretin/calcitonin family of GPCRs) being non-covalently bound at the cell membrane. Latrophilin-1 has been shown to recruit the neurotoxin from black widow spider venom, alpha-latrotoxin, to the synapse plasma membrane. Alternative splicing results in multiple variants encoding distinct isoforms.[provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a targeted null allele at this locus are viable and fertile. Female homozygotes fail adequately to care for their litters. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	G	T	6: 96,165,289	P258Q	probably damaging	Het
4930452B06Rik	G	T	14: 8,511,110	H435N	probably benign	Het
Acbd5	G	A	2: 23,090,551	C312Y	probably damaging	Het
Agbl4	G	A	4: 111,657,168	E459K	probably benign	Het
Anxa2	TCCC	TCC	9: 69,489,754		probably null	Het
Casz1	C	T	4: 148,929,087	A36V	possibly damaging	Het
Chpf	A	G	1: 75,476,648	V327A	probably damaging	Het
Cldn23	A	G	8: 35,825,930	Y135H	probably damaging	Het
Cobll1	C	T	2: 65,133,642	D211N	probably damaging	Het
Cramp1l	A	G	17: 24,983,951	V368A	probably benign	Het
Dnah6	T	C	6: 73,144,963	T1374A	probably benign	Het
Dpyd	A	G	3: 119,065,006	H623R	probably benign	Het
Dyrk2	T	C	10: 118,859,925	N476S	probably benign	Het
Endog	A	T	2: 30,173,887	I267F	probably damaging	Het
Ephb6	A	T	6: 41,614,373	K155*	probably null	Het
Far2	T	C	6: 148,157,458	V214A	possibly damaging	Het
Fat2	A	G	11: 55,278,924	V3003A	probably damaging	Het
Frg2f1	T	A	4: 119,531,288	T5S	possibly damaging	Het
Gm14496	A	T	2: 181,996,179	T349S	probably benign	Het
Golgb1	A	G	16: 36,926,101	T2951A	probably benign	Het
Hc	G	T	2: 35,006,161	D1203E	probably benign	Het
Isg20	C	A	7: 78,914,509	Q55K	possibly damaging	Het
Jph4	G	T	14: 55,114,103	A152E	probably damaging	Het
Kcnq3	T	C	15: 66,025,260	T264A	probably damaging	Het
Kcnq5	T	G	1: 21,457,461	T463P	probably damaging	Het
Klra8	A	G	6: 130,119,018	S204P	probably damaging	Het
Ldlrad1	A	G	4: 107,214,875	D98G	probably damaging	Het
Lhfpl4	T	C	6: 113,194,136	T30A	possibly damaging	Het
Lig1	T	A	7: 13,285,340	L80Q	probably damaging	Het
Lmbrd2	A	G	15: 9,186,612	Y558C	probably benign	Het
Lrrn3	G	T	12: 41,452,993	L442I	possibly damaging	Het
Mc2r	A	G	18: 68,407,448	F258S	probably damaging	Het
Mmp16	A	G	4: 18,011,582	T137A	probably benign	Het
Nfatc2ip	A	T	7: 126,387,407	S359T	probably damaging	Het
Nup214	C	T	2: 32,034,466	S1669F	probably damaging	Het
Olfr1193	A	T	2: 88,678,574	K233*	probably null	Het
Olfr1229	T	C	2: 89,282,821	H104R	probably damaging	Het
Olfr514	T	A	7: 108,825,924	H25L	probably benign	Het
Olfr904	C	T	9: 38,464,631	L197F	probably damaging	Het
Plagl1	C	T	10: 13,128,962		probably benign	Het
Plxnb2	A	T	15: 89,158,493	S1531T	probably damaging	Het
Ptpn22	G	A	3: 103,902,196		probably null	Het
Rtn1	T	A	12: 72,219,279	Q174L	possibly damaging	Het
Selenoo	A	G	15: 89,099,916	E645G	probably benign	Het
Serpina1a	A	C	12: 103,853,837	D383E	possibly damaging	Het
Slc6a18	T	A	13: 73,668,225	Y345F	probably benign	Het
Smbd1	A	G	16: 32,806,765	V51A	possibly damaging	Het
Tchh	C	T	3: 93,444,839	R529W	unknown	Het
Tmem206	A	G	1: 191,345,065	D195G	probably benign	Het
Tonsl	A	T	15: 76,638,557	Y165N	probably damaging	Het
Trdmt1	G	A	2: 13,516,059	T344I	probably damaging	Het
Ubash3b	C	A	9: 41,043,500	R116L	probably damaging	Het
Vmn2r94	A	G	17: 18,243,733	V765A	probably damaging	Het
Zfp474	C	T	18: 52,638,365	T30I	probably benign	Het

Other mutations in Adgrl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00965:Adgrl1	APN	8	83937703	missense	probably damaging	0.98
IGL01413:Adgrl1	APN	8	83929857	missense	probably damaging	1.00
IGL02020:Adgrl1	APN	8	83932948	missense	probably benign	0.09
IGL02422:Adgrl1	APN	8	83937486	missense	probably damaging	1.00
IGL03065:Adgrl1	APN	8	83938514	missense	possibly damaging	0.95
IGL03169:Adgrl1	APN	8	83931995	missense	probably damaging	0.97
IGL03237:Adgrl1	APN	8	83929683	splice site	probably null
Swiss_rolls	UTSW	8	83918922	missense	probably damaging	0.99
R0375:Adgrl1	UTSW	8	83934901	missense	probably damaging	0.99
R0505:Adgrl1	UTSW	8	83934650	splice site	probably benign
R0681:Adgrl1	UTSW	8	83934650	splice site	probably benign
R0964:Adgrl1	UTSW	8	83934412	splice site	probably benign
R1182:Adgrl1	UTSW	8	83929822	missense	probably damaging	1.00
R1373:Adgrl1	UTSW	8	83937763	missense	probably benign	0.23
R1475:Adgrl1	UTSW	8	83938350	missense	possibly damaging	0.60
R1778:Adgrl1	UTSW	8	83930037	missense	probably damaging	1.00
R2089:Adgrl1	UTSW	8	83934464	missense	probably damaging	1.00
R2091:Adgrl1	UTSW	8	83934464	missense	probably damaging	1.00
R2091:Adgrl1	UTSW	8	83934464	missense	probably damaging	1.00
R2300:Adgrl1	UTSW	8	83930117	nonsense	probably null
R2403:Adgrl1	UTSW	8	83931241	missense	probably benign	0.01
R2935:Adgrl1	UTSW	8	83934560	missense	probably damaging	1.00
R3772:Adgrl1	UTSW	8	83923004	missense	possibly damaging	0.59
R4191:Adgrl1	UTSW	8	83938940	missense	probably benign	0.29
R4393:Adgrl1	UTSW	8	83938593	missense	probably benign	0.01
R4406:Adgrl1	UTSW	8	83930042	missense	probably damaging	1.00
R4445:Adgrl1	UTSW	8	83934860	missense	probably damaging	1.00
R4782:Adgrl1	UTSW	8	83935573	missense	probably benign	0.08
R4799:Adgrl1	UTSW	8	83935573	missense	probably benign	0.08
R5214:Adgrl1	UTSW	8	83915573	splice site	probably null
R5242:Adgrl1	UTSW	8	83931082	missense	possibly damaging	0.47
R5409:Adgrl1	UTSW	8	83929742	missense	probably damaging	1.00
R5522:Adgrl1	UTSW	8	83923075	missense	possibly damaging	0.93
R5607:Adgrl1	UTSW	8	83937257	missense	probably damaging	1.00
R5608:Adgrl1	UTSW	8	83937257	missense	probably damaging	1.00
R5652:Adgrl1	UTSW	8	83929815	missense	probably damaging	1.00
R5655:Adgrl1	UTSW	8	83938601	missense	possibly damaging	0.89
R5919:Adgrl1	UTSW	8	83932610	missense	probably damaging	1.00
R6033:Adgrl1	UTSW	8	83918922	missense	probably damaging	0.99
R6033:Adgrl1	UTSW	8	83918922	missense	probably damaging	0.99
R6129:Adgrl1	UTSW	8	83918987	missense	probably damaging	1.00
R6221:Adgrl1	UTSW	8	83937687	nonsense	probably null
R7142:Adgrl1	UTSW	8	83937200	missense	probably benign	0.38
R7181:Adgrl1	UTSW	8	83926249	splice site	probably null
R7238:Adgrl1	UTSW	8	83939064	missense	probably damaging	0.99
R7547:Adgrl1	UTSW	8	83938884	missense	probably benign	0.00
R7709:Adgrl1	UTSW	8	83938988	missense	probably benign	0.03
R7741:Adgrl1	UTSW	8	83929714	missense	probably damaging	1.00
R7852:Adgrl1	UTSW	8	83935558	missense	probably damaging	1.00
R7866:Adgrl1	UTSW	8	83937935	critical splice donor site	probably null
R8146:Adgrl1	UTSW	8	83930989	missense	possibly damaging	0.64
R8314:Adgrl1	UTSW	8	83938389	missense	probably damaging	1.00
R8829:Adgrl1	UTSW	8	83938829	missense
R8857:Adgrl1	UTSW	8	83931028	missense	probably benign	0.24
R8979:Adgrl1	UTSW	8	83938386	missense	probably benign	0.12
R9204:Adgrl1	UTSW	8	83933890	missense	probably benign	0.03
R9226:Adgrl1	UTSW	8	83929797	missense	possibly damaging	0.91
R9302:Adgrl1	UTSW	8	83929797	missense	possibly damaging	0.91
R9695:Adgrl1	UTSW	8	83938431	missense	probably damaging	0.99
R9785:Adgrl1	UTSW	8	83938539	missense	probably damaging	1.00
RF007:Adgrl1	UTSW	8	83934772	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- TGCCACCCTACAATGACCAGTGAG -3'
(R):5'- TGACATTGTCAGCCAGCAGGAAG -3'

Sequencing Primer
(F):5'- CCTACAATGACCAGTGAGGGATG -3'
(R):5'- CTCCAGGACATCTAGAAGCATGG -3'

Posted On

2014-04-24